Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New application of motherwort

A technology of motherwort and its uses, applied in the direction of medical preparations containing active ingredients, pharmaceutical formulas, metabolic diseases, etc., can solve problems such as unclear mechanism of action, active ingredients of drugs, unclear active parts, and insufficient research

Active Publication Date: 2019-08-06
CAPITALBIO CORP +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the main bottlenecks in the research and development of blood lipid-lowering traditional Chinese medicines are that the active ingredients and active parts of the medicine are not clear, the mechanism of action is unclear or the research is not thorough enough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New application of motherwort
  • New application of motherwort

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Experimental method:

[0030] 1. Design paired probes for genes: design paired probes for the junction sequences of two adjacent exons of the selected gene to avoid contamination of the genome.

[0031]2. Cells treated with 20 kinds of traditional Chinese medicine extracts: HepG2 cells were purchased from Union College of Basic Medical Sciences, Chinese Academy of Medical Sciences, cultured in DMEM medium containing 10% fetal bovine serum, and cultured at a constant temperature of 37°C. Cells with logarithmic growth were selected and seeded in 384-well plates, each well containing 3000 cells and 80 μL of medium. After incubation at 37°C for 24 hours. Quantitatively add 0.4 μL motherwort with a concentration of 25mg / mL in the cell culture well, motherwort boy, Rhizoma chinensis, Spatholobus, Rhizoma Polygonatum, Ophiopogon japonicus, Kunming Spatholobus, Gentian, Vitex unifolia, lentils, Extracts of Patrinia alba, Prunella vulgaris, Prunella lanceolata, Scallop, Pat...

Embodiment 2

[0046] Use the real-time quantitative gene amplification fluorescence detection system, that is, the qPCR method to verify the expression of HMGCR, LDLR, and HMGCS1 genes, and at the same time verify Motherwort. The specific experimental process is as follows:

[0047] 1. The cells were treated with the extracts of motherwort and motherwort respectively.

[0048] 2. Use the kit to extract RNA and reverse to cDNA.

[0049] 3. RT-qPCR reaction, program: 95°C, 3min; (95°C, 3s; 60°C, 30s) 40 cycles.

[0050] Among them, the primer sequence is:

[0051] HMGCR: upstream primer TGATTGACCTTTCCAGAGCAAG,

[0052] downstream primer TGATTGACCTTTCCAGAGCAAG;

[0053] LDLR: upstream primer ACCAACGAATGCTTGGACAAC,

[0054] downstream primer ACAGGCACTCGTAGCCGAT;

[0055] HMGCS1: upstream primer CATTAGACCGCTGCTATTCTGTC,

[0056] downstream primer TTCAGCAACATCCGAGCTAGA;

[0057] 4. Data processing: the gene expression level of the blank control group was regarded as 1, and the gene express...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of traditional Chinese medicines and discloses novel application of all-grass of leonurus japonicas. The invention provides application of the all-grass of leonurus japonicas in preparation of medicines with a lipid-lowering effect. Tests show that the change factor of all-grass of leonurus japonicas on LDLR genes is 4.23 and is obviously higher than that of other traditional Chinese medicine extracts. Moreover, the all-grass of leonurus japonicas can further up-regulate expression of the LDLR genes and down-regulate expression of HMGCR genes and HMGCS1 genes, so that cholesterol synthesis is reduced. The all-grass of leonurus japonicas has the effect of lowering lipid.

Description

technical field [0001] The invention belongs to the field of traditional Chinese medicines, and in particular relates to a new application of motherwort, especially the use of motherwort in preparing lipid-lowering medicines. Background technique [0002] Hyperlipidemia refers to excessive blood lipid levels, which can directly cause some diseases that seriously endanger human health, such as atherosclerosis, coronary heart disease, pancreatitis, etc., especially cardiovascular diseases. Around the world, 30 million people die every year from related diseases caused by hyperlipidemia, and the most serious one is cardiovascular disease. With the improvement of living standards, the morbidity and mortality of coronary heart disease in my country have also increased significantly, and the number of patients with hypertension has increased by 25% in 10 years, reaching about 200 million people at present. According to statistics from the Ministry of Health, one-third of patients...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K36/533A61P3/06
CPCA61K36/533
Inventor 谢兰王栋张卫东孙义民安燕南邵伟李慧梁郭弘妍李莎莎邢婉丽程京
Owner CAPITALBIO CORP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com