Milbemycin positive regulation gene milR and overexpressed genetic engineering bacterium, preparation method and application thereof

A technology of milbemycin and genetically engineered bacteria, applied in genetic engineering, botany equipment and methods, methods based on microorganisms, etc., can solve problems such as failure

Active Publication Date: 2016-12-07
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although the milbemycin series products have huge commercial value, countries all over the world are also scrambling to develop and produce milbemycin strains, but they have not succeeded. In the past half a century, only Japan Sankyo Company has monopolized the production of milbemycin technical

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Milbemycin positive regulation gene milR and overexpressed genetic engineering bacterium, preparation method and application thereof
  • Milbemycin positive regulation gene milR and overexpressed genetic engineering bacterium, preparation method and application thereof
  • Milbemycin positive regulation gene milR and overexpressed genetic engineering bacterium, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The research of embodiment 1milR gene function

[0031] 1. Construction of recombinant plasmids for gene disruption

[0032] Using primer RD-LF (5'CG GAATTCCAGCGACACCATCACCGAGAACA3', the underline is the EcoRI site) and RD-LR (5'CGG GGTACC GACTGAGCGAGTCGGAAATT3', the underline is the KpnI site) PCR amplified from the Streptomyces bingchengsis X-7 genome to obtain the homologous recombination left arm fragment of the milR gene. The total PCR reaction system is 100 μl, and the reaction conditions are: 94°C, 4min; 94°C, 1min, 68°C, 3min, 31 cycles; 68°C, 10min. After the PCR product was loaded and electrophoresed, the target band with a length of 2.2kb was recovered, and then the recovered fragment was digested with EcoRI and KpnI.

[0033] Using primer RD-RF (5'CG GGATCC CAGCAGTCGGCTCAGCAACG3', BamHI site is underlined) and RD-RR (5'GC TCTAGA CTCGAAATCCTTCTGGGTCAGGT3'), the underline is the XbaI site) PCR amplified from the Streptomyces bingchengsis X-7 genome to...

Embodiment 2

[0045] Embodiment 2, the construction of milbemycin high-yielding engineering strain

[0046] Transform E.coli ET12567 / pUZ8002 competent cells with the recombinant vector pSET152::milR used for complementation in Example 1 to obtain a single clone of E.coli ET12567 / pUZ8002 containing pSET152::milR, which was transferred into Streptomyces bingchenggensis BC- In the 120-4 strain, the process is to pick a single clone and inoculate it in the liquid LB medium with corresponding resistance (add 100 μg / ml apramycin and 25 μg / ml chloramphenicol during cultivation); cultivate overnight at 37°C; The overnight culture was inoculated in liquid LB medium supplemented with corresponding antibiotics at a ratio of 1:100, and cultivated at 37°C until OD600=0.4-0.6; centrifuged, collected bacteria, and washed the bacteria twice with an equal volume of liquid LB medium. Once, use 1 / 10 volume of 2YT to suspend; while washing E. coli cells, use 2×YT medium to collect Streptomyces spores, transfer...

Embodiment 3

[0049] The difference from Example 1 is that Streptomyces bingchengsis X-7 is replaced by Streptomyces bingchenggensis BC-120-4. Other steps are with embodiment 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a milbemycin positive regulation gene milR and an overexpressed genetic engineering bacterium, a preparation method and application thereof. The sequence of the milbemycin positive regulation gene milR is shown as SEQ ID NO.1, an overexpression plasmid containing the gene and a promoter sequence is established and converts an escherichia coli host cell, conjugational transfer is conducted on the obtained converter and streptomyces bingchengensis, a zygote having apramycin resistance is picked, namely the genetic engineering bacterium having high milbemycin yield can be obtained, and the milbemycin can be produced by fermenting the genetic engineering bacterium. The yield of milbemycin A3 / A4 is improved, the production cost is reduced, and the economic benefit is improved.

Description

technical field [0001] The invention relates to a milbemycin positive regulation gene milR and its overexpression genetic engineering bacteria, preparation method and application Background technique: [0002] Milbemycin is a sixteen-membered macrolide compound, which has a similar chemical structure to abamectin. Milbemycin was first discovered by Sankyo Company of Japan in 1967, and it was produced by the fermentation broth of the soil actinomycetes Streptomyces hygroscopicus subsp.aureolacrimosus. The mixture of milbemycin components A3 and A4 has higher acaricidal activity than avermectin, the most widely used high-efficiency biological pesticide at present, and its toxicity to rats is 40 times lower than that of abamectin. Therefore, it is identified as a less dangerous pesticide by the US Environmental Protection Agency, and the Netherlands has approved it as "GNO" (natural product in crop production). It is an eco-friendly pesticide and is suitable for integrated pes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N1/21C12N15/03C12P17/18C12R1/465
CPCC07K14/36C12N15/03C12P17/181
Inventor向文胜张艳艳张继王相晶何海荣
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI