A molecular improvement method for reducing rice grain shattering

A technology of rice shattering and rice, which is applied in the field of rice biotechnology breeding, can solve the problems of harvest yield reduction, shattering harvest yield loss, easy grain drop, etc., to save time and cost, improve work efficiency, and genome DNA The effect of little damage

Active Publication Date: 2020-03-20
HUNAN AGRICULTURAL UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, for the common cultivated rice varieties (combinations) that are currently used in actual production by humans, the excessive grain shattering will cause a large loss of harvest yield due to a large number of grains falling in the field when harvesting, so it is not popular.
Although after artificial domestication and improvement, the grain shattering of most cultivated rice varieties is relatively moderate, there are still some varieties, especially some backbone parents of indica hybrid rice and their combinations (such as R1128, Guangliangyou 1128, etc.) Reduced harvest yield due to easy kernel drop

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular improvement method for reducing rice grain shattering
  • A molecular improvement method for reducing rice grain shattering
  • A molecular improvement method for reducing rice grain shattering

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention will be further clarified through the detailed description of specific embodiments below, but it is not intended to limit the present invention, but only for illustration.

[0030] The present invention uses the CRISPR / Cas9 system to target and modify the rice shattering gene qSH1 to reduce the molecular genetic improvement method of rice (indica rice variety R1128) shattering, which includes the following steps:

[0031] 1) According to the Nipponbare qSH1 reference sequence, the double-stranded fragment of the indica rice R1128qSH1 coding region was cloned and sequenced;

[0032] 2) According to the above sequencing and splicing results, design two target sequences in the R1128qSH1 coding region and the upstream region of the 5' end of the start codon:

[0033] Target-qSH1-1 (SEQ ID NO.1): GCGCCATGTCGTCCGCCGCT

[0034] Target-qSH1-5 (SEQ ID NO.2): ACATGGCGCGCACGCACGTA

[0035] The above two target sequences both contain 5'-(N) X -NGG-3' st...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular genetic improvement method for lowering rice seed holding by targeted modification on rice seed holding gene qSH1 by using a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 system. The method comprises the following steps: 1) selecting an appropriate target; 2) establishing a vector containing the target spot sequence; 3) establishing a recombinant vector containing the target spot sequence by utilizing the vector; 4) introducing the recombinant vector into receptor rice to obtain a transgenic positive plant; 5) obtaining a targeted-mutation mutant plant by utilizing the transgenic positive plant; 6) carrying out additive-generation growth on the mutant plant to obtain a transgenic-component-free homozygous mutant plant; and 7) carrying out seed holding investigation by using the homozygous mutant plant to obtain the plant with obviously lower seed holding as the seed-holding-improved plant. The method has the advantages of high directionality, small genetic background changes and the like, can avoid the risks caused by genetic transformation, and can culture the new species and new combination of transgenic-component-free rice with obviously lower seed holding.

Description

technical field [0001] The invention belongs to the field of rice biotechnology breeding, and in particular relates to a molecular genetic improvement method for using a CRISPR / Cas9 system to target-modify qSH1 to reduce rice grain shattering. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in the world, and more than half of the world's population uses rice as the main food. In my country, rice is also the most important food crop. As the largest ration crop, about 65% of my country's population takes rice as a staple food. However, with the increase of population and the decrease of arable land, the problem of imbalance between supply and demand of food has become increasingly serious. Therefore, rice production is closely related to economic development, social stability, and national security, and it plays a pivotal role in ensuring my country's food security. [0003] Rice grain shattering is one of the important agronomic traits closely...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/10A01H6/46
CPCC07K14/415C12N15/8261
Inventor段美娟盛夏冰袁定阳孙志忠谭炎宁余东袁光杰袁贵龙
OwnerHUNAN AGRICULTURAL UNIV