Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mutant cytokine fusion protein for treating metabolic diseases

A cytokine and fusion protein technology, applied in metabolic diseases, fibroblast growth factors, cells modified by introducing foreign genetic material, etc., can solve the problems of low efficiency, time-consuming and labor-intensive in mammalian cells, and achieve better hypoglycemic effect. Good, lower blood sugar level, good effect of blood sugar fluctuation

Active Publication Date: 2017-02-15
哈尔滨资治生物科技有限公司
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the low efficiency of introducing foreign genes into mammalian cells, it is time-consuming and laborious to screen high-expressing cell clones from engineered cells that integrate and express foreign genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant cytokine fusion protein for treating metabolic diseases
  • Mutant cytokine fusion protein for treating metabolic diseases
  • Mutant cytokine fusion protein for treating metabolic diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of mhFGF21 gene

[0036] Four primers were designed, and the mhFGF21 protein gene was constructed by overlapping PCR method.

[0037] The 4 primers were designed as follows:

[0038] P1: 5' GGATCCAGCCACCCCATCCCTGACTCCAGTCCTCT 3'

[0039] P2: 5' GGATTCCGGGTGGCTCCGGGGGTGCGGGGGG 3'

[0040]P3: 5' CCAGGCCTGCCCCCCGCAC CCCCGGAGCCACCC 3'

[0041] P4: 5' CGGAATTCTTAGGAAG TGTAGCTGGGGC 3'

[0042] 1. Amplification of the first segment of mhFGF21

[0043] The first segment of the mhFGF21 gene was obtained by using the PCR method with the plasmid containing the hFGF21 gene as a template and P1 and P2 as primers. The amplification system was 25 µl, and the cycle parameters were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 50°C for 1 min, extension at 72°C for 1 min, cycle=15, and final extension at 72°C for 10 min. After the amplification, 2 µl of the mixture was taken to observe the amplification results ...

Embodiment 2

[0048] Example 2 Construction of Fc gene

[0049] Referring to molecular cloning methods, total RNA was extracted from human blood with Trizol, and cDNA was reverse-transcribed as a template. Using the Fc of human IgG4 as a template, design the following primers

[0050] P5 5' GCGGAGTCCAAATATGGTCCCCC 3'

[0051] P6 5’ TTAACCCAGAGACAGGGAGA 3’

[0052] The Fc gene of human IgG4 was obtained by using PCR method with cDNA as template and P5 and P6 as primers.

Embodiment 3

[0053] Example 3 Construction of mhFGF21-Fc gene

[0054] Design 4 primers, use overlapping PCR method to construct mhFGF21-Fc protein gene, use mhFGF21 and Fc (Gly4-Ser) 3 Linker (sequence is 5'GGTGGCGGTGGCTCCGGCGGTGGTGGGTCGGGTGGC GGCGGATCT 3') connection. The 4 primers were designed as follows:

[0055] P7 5 GGATCC AGCCACCCCATCCCTGACTCCAG 3’

[0056] P8 5' CCACCCGACCCACCACCGCCGGAGCCACCGCCACCGGAAGTGTAGCTGGGGCTTC 3'

[0057] P9 5'GGTGGCGGTGGCTCCGGCGGTGGTGGGTCGGGTGGCGGCGGATCTGCGGAGTCCAAAT 3'

[0058] P10 5’CGCGAATTC TTA ACCCAGAGACAGGGAGA 3’

[0059] 1. Amplification of the first segment of mhFGF21-Fc

[0060] The first segment of the mhFGF21-Fc gene was obtained by using the PCR method with the plasmid containing the mhFGF21 gene as a template and P7 and P8 as primers. The amplification system was 25 µl, and the cycle parameters were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 48°C for 1 min, extension at 72°C for 1 min, c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the effect of a novel mutant human cytokine and fusion protein thereof on treatment of metabolic diseases. The human cytokine with mutant expression in mammalian cells is protein as shown in SEQ ID No. 3 in a sequence table. According to the invention, a wild human cytokine gene is subjected to mutation and N-terminal reconstruction, and the fusion protein contains a human cytokine mutant and the Fc segment (CH2-CH3) of human IgG4. The mammalian cell-expressed recombinant cytokine fusion protein has good activity in reducing blood sugar; in particular, the fusion protein has the advantages of high stability, long half life, etc.; and the fusion protein can well control fluctuation of blood sugar and stably maintain blood sugar at a normal level within 24 h.

Description

technical field [0001] The present invention relates to mutated cytokines, in particular to mutated human-derived cytokines, and also relates to the use of the mutated human-derived cytokines in the preparation of drugs for treating metabolic diseases, which belongs to the field of mutated cytokines. Background technique [0002] Diabetes is a serious metabolic disease that endangers the world. At present, there are about 40 million diabetic patients in my country, and the prevalence rate has increased from 1% more than ten years ago to 2.5% at present, and it is increasing at a rate of 1‰ every year. Diabetes has become the third biggest killer threatening human health after cardiovascular and cerebrovascular diseases and cancer. [0003] At present, there is still a lack of cure for diabetes. Clinically, diabetes is mainly controlled by drugs. Patients need to take drugs for life to achieve the purpose of controlling blood sugar levels, reducing symptoms of diabetes, and d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/50C07K19/00C12N15/12C12N15/62C12N15/85C12N5/10A61K38/18A61P3/00A61P3/10A61P3/04
CPCA61K38/00C07K14/50C07K2319/30
Inventor 不公告发明人
Owner 哈尔滨资治生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com