Gene detection or gene typing composition and method thereof
A technology of genotyping and gene detection, applied in biochemical equipment and methods, recombinant DNA technology, measurement/testing of microorganisms, etc., can solve the problems of gene detection and genotyping without DNA silencing phenomenon, and achieve simple gene detection or genotyping effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1 PCR process
[0044] The 5'UTR of HCV 1a genotype was selected as the target, and its sequence is as follows:
[0045] GCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCG GGAGAGCCATAGTGGTCTG CGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATAAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCC CCGGGAGGTCTCGTAG ACCGTGCACC (SEQ ID NO: 1).
[0046] Design the target enrichment primers as follows (underlined) according to the routine requirements in this field:
[0047] F: GGAGAGCCATAGTGGTCTG (SEQ ID NO: 2),
[0048] R: CTACGAGACCTCCCGG (SEQ ID NO: 3).
[0049] The size of the target sequence amplified by the two primers is 200bp.
[0050] Prepare PCR reaction solution: 20mM Tris / HCl, pH 8, 250mM KCl, 300μM Mg 2+ , 250μM upstream and downstream primers, 5U Taq enzyme, template amount 10ng. PCR reaction conditions...
Embodiment 2
[0051] Embodiment 2 positioning cutting process and electrophoresis process
[0052] 2.1 Length of positioning primer
[0053] In various genetic tests, one or more gene variations may occur, and these genes may be the human body's own genes or pathogen genes. Targeting primers with different bases and different lengths need to be designed for different target gene targets. The present invention can use more than 12bp positioning primers. In 20mM Tris / HCl, pH 8, 300μM Mg 2+, 75°C for 1 hour, the following positioning primers (double strands) with a length of 5 to 80 bp were respectively mixed with 5 μg of cutting enzyme (Argonaute enzyme, derived from Thermus thermophiles, see http: / / www.ncbi. nlm.nih.gov / gene / ?term=TTHB068) and 500ng target gene (PCR product in Example 1) react together, the results are shown in figure 2 . Depend on figure 2 It can be seen that the positioning primers of 12, 20, 40, and 80 bp can all achieve cleavage. Longer positioning primers highe...
Embodiment 3
[0077] Embodiment 3 The example of positioning cutting reaction process
[0078] The target gene used in the above examples is the 5'UTR of HCV 1a genotype, and for a 5'UTR of HCV 3a genotype, the CTG position of the target target corresponds to TCA. Therefore, when using the positioning primers of the above-mentioned embodiments, it is impossible to perform cleavage to form fragments of corresponding sizes. This example again verified the efficacy of the system of the present invention for the 5'UTR of HCV 3a genotype. Specifically, the target enrichment primer and its implementation in this example are the same as in Example 1, and the positioning double-stranded primer is designed at the same time: P-AAGATCACTAGC (SEQ ID NO: 15), and the positioning primer is HCV 3a genotype-specific . Other reaction conditions are with embodiment 2. The results showed that when using the positioning primer and Agonaute enzyme, the fragment of the amplified HCV 3a genotype 5'UTR could be...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com