Litchi leaf specific expression gene LcGRX promoter and application thereof
A technology for expressing genes and promoters, applied in the field of promoters, can solve problems such as affecting the normal growth and development of plants, plant death, and breaking the metabolic balance of plants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Obtaining of Litchi Leaf Specific Expression Gene LcGRX Promoter Sequence
[0047] Pick the mature functional leaves and newly opened flowers that are free from diseases and insect pests in the middle of the fruiting mother branch, transport them back to the laboratory within 3 hours, wash them with sterile water, absorb excess water, freeze them quickly in liquid nitrogen, and store them in a -80°C ultra-low temperature refrigerator for later use. Pick eight-ripe "Concubine Smile" fruits and transport them back to the laboratory within 3 hours, select healthy fruits without pests and diseases, rinse them with sterilized water several times, absorb excess water, peel off the peel, seeds and pulp, and freeze them in liquid nitrogen at -80°C Store in ultra-low temperature refrigerator for later use. Healthy seedlings were cultivated from the mature seeds of "Concubine Smile" in the seedling plug. After 3 months, the roots were taken out, rinsed with sterile wate...
Embodiment 2
[0057] Example 2 Investigation of the expression pattern of litchi LcGRX gene in different tissues
[0058] Since the expression of the litchi actin (actin) gene is basically the same in various tissues of the litchi, actin is generally used as an internal reference gene to detect the relative expression of the litchi gene.
[0059] Design the following specific RT-PCR primers:
[0060] Act-F: CAACTGGTATTGTCTTGGATTCTG;
[0061] Act-R: TCATCAAGGCATCGGTTAGA.
[0062] LcGRX-RT-F:AAGACCTCTTGTTGCATCAGCT;
[0063] LcGRX-RT-R: CACCTCCTACGAGTTCTTGACC.
[0064] The RT-PCR reaction system is as follows:
[0065]
[0066] The reaction conditions were: pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s; annealing at 60°C for 34s; cycle 40 times, extension at 72°C for 8min.
[0067] The results of quantitative PCR analysis showed that LcGRX gene was highly expressed in leaves of litchi, and its expression was lower in the other five tissues, especially in the pulp. It w...
Embodiment 3
[0068] Embodiment 3 Construction of plant LcGRX gene promoter expression vector
[0069] 1) Use the promoter sequence of the litchi leaf-specific expression gene LcGRX as shown in SEQ ID NO.1 as a template to design primer pairs, and add Pst I, EcoR I restriction sites and protective bases to the primer pairs, as follows:
[0070] Forward primer P1: 5'-GTGCCCCATGACTTATTTTAT-3';
[0071] Reverse primer P2: 5'-TCTTTCACCAACCTTGCTATT-3'.
[0072] PCR was carried out using the promoter sequence of the litchi leaf-specific expression gene LcGRX as a template, and the PCR amplification conditions were as follows:
[0073] reaction system:
[0074]
[0075] The reaction program was: pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 30 seconds; annealing at 61°C for 30 seconds; extension at 72°C for 2 minutes, after 35 cycles; extension at 72°C for 8 minutes; PCR product 1 was obtained;
[0076] 3) A primer pair is designed with the lychee-like sweet protein LcTLP ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com