Unlock instant, AI-driven research and patent intelligence for your innovation.

Litchi leaf specific expression gene LcGRX promoter and application thereof

A technology for expressing genes and promoters, applied in the field of promoters, can solve problems such as affecting the normal growth and development of plants, plant death, and breaking the metabolic balance of plants

Inactive Publication Date: 2017-05-10
ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because constitutive promoters can regulate the expression of genes in various plant tissues to varying degrees, resulting in the accumulation of heterologous proteins or metabolites in various organs of the plant, breaking the original metabolic balance of plants, and even producing toxins. It will affect the normal growth and development of plants, and even cause the death of plants. In addition, it will also bring food safety and other related problems to humans.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Litchi leaf specific expression gene LcGRX promoter and application thereof
  • Litchi leaf specific expression gene LcGRX promoter and application thereof
  • Litchi leaf specific expression gene LcGRX promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Obtaining of Litchi Leaf Specific Expression Gene LcGRX Promoter Sequence

[0047] Pick the mature functional leaves and newly opened flowers that are free from diseases and insect pests in the middle of the fruiting mother branch, transport them back to the laboratory within 3 hours, wash them with sterile water, absorb excess water, freeze them quickly in liquid nitrogen, and store them in a -80°C ultra-low temperature refrigerator for later use. Pick eight-ripe "Concubine Smile" fruits and transport them back to the laboratory within 3 hours, select healthy fruits without pests and diseases, rinse them with sterilized water several times, absorb excess water, peel off the peel, seeds and pulp, and freeze them in liquid nitrogen at -80°C Store in ultra-low temperature refrigerator for later use. Healthy seedlings were cultivated from the mature seeds of "Concubine Smile" in the seedling plug. After 3 months, the roots were taken out, rinsed with sterile wate...

Embodiment 2

[0057] Example 2 Investigation of the expression pattern of litchi LcGRX gene in different tissues

[0058] Since the expression of the litchi actin (actin) gene is basically the same in various tissues of the litchi, actin is generally used as an internal reference gene to detect the relative expression of the litchi gene.

[0059] Design the following specific RT-PCR primers:

[0060] Act-F: CAACTGGTATTGTCTTGGATTCTG;

[0061] Act-R: TCATCAAGGCATCGGTTAGA.

[0062] LcGRX-RT-F:AAGACCTCTTGTTGCATCAGCT;

[0063] LcGRX-RT-R: CACCTCCTACGAGTTCTTGACC.

[0064] The RT-PCR reaction system is as follows:

[0065]

[0066] The reaction conditions were: pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s; annealing at 60°C for 34s; cycle 40 times, extension at 72°C for 8min.

[0067] The results of quantitative PCR analysis showed that LcGRX gene was highly expressed in leaves of litchi, and its expression was lower in the other five tissues, especially in the pulp. It w...

Embodiment 3

[0068] Embodiment 3 Construction of plant LcGRX gene promoter expression vector

[0069] 1) Use the promoter sequence of the litchi leaf-specific expression gene LcGRX as shown in SEQ ID NO.1 as a template to design primer pairs, and add Pst I, EcoR I restriction sites and protective bases to the primer pairs, as follows:

[0070] Forward primer P1: 5'-GTGCCCCATGACTTATTTTAT-3';

[0071] Reverse primer P2: 5'-TCTTTCACCAACCTTGCTATT-3'.

[0072] PCR was carried out using the promoter sequence of the litchi leaf-specific expression gene LcGRX as a template, and the PCR amplification conditions were as follows:

[0073] reaction system:

[0074]

[0075] The reaction program was: pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 30 seconds; annealing at 61°C for 30 seconds; extension at 72°C for 2 minutes, after 35 cycles; extension at 72°C for 8 minutes; PCR product 1 was obtained;

[0076] 3) A primer pair is designed with the lychee-like sweet protein LcTLP ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a litchi leaf specific expression gene LcGRX promoter and application thereof. The invention provides (1) a method for obtaining a primer sequence of the litchi leaf specific expression gene LcGRX promoter, (2) a construction method of a recombinant expression vector which takes pCAMBIA1304 as a basic expression vector and contains the LcGRX promoter and an LcTLP gene segment, and (3) a method for verifying the function of the promoter by using biolistic transformation and GUS transient gene expression. An experiment shows that the litchi leaf specific expression promoter is cloned from litchi and is verified to be a promoter for tissue specific expression, so that a basis is supplied to further transgenic breeding of litchi.

Description

technical field [0001] The invention relates to the field of promoters, in particular to a promoter of litchi leaf-specific expression gene LcGRX and its application. Background technique [0002] Litchi is an important fruit tree in South China and occupies an important position in the agricultural economy. However, the pre-harvest fruit is vulnerable to the damage of pedicle borers and other hazards, which leads to serious fruit drop, thereby reducing the yield of litchi; after harvest, the litchi fruit is not resistant to storage, the skin is browned, the disease is serious, and the shelf life of litchi is shortened due to water loss and cracking. , which reduces the commodity value of litchi and limits the development of litchi industry. Breeding new varieties with multi-resistance, high-quality and storability is the fundamental way to solve these problems. However, due to the narrow genetic base of litchi and the lack of resistance resources, the progress of resistan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/10C12N15/82C12N15/66A01H5/00
CPCC07K14/415C12N15/8225
Inventor 王家保孙琴王树军孙进华李焕苓王果
Owner ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI