Recombinant baculovirus vector resistant to host apoptosis

A recombinant baculovirus and anti-host technology, applied in the direction of virus/bacteriophage, virus, antibody medical components, etc., can solve the problems that the protein expression level cannot be significantly increased, and the speed and degree of insect cell disease cannot be reduced, etc., to achieve the goal of exogenous protein The effect of increasing expression level, avoiding degradation, and increasing protein expression level

Inactive Publication Date: 2017-05-10
NORTHWEST A & F UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After the current recombinant baculovirus infects insect cells, the speed and degree of insect cell damage cannot be reduced, and the protein expression level cannot be significantly increased

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant baculovirus vector resistant to host apoptosis
  • Recombinant baculovirus vector resistant to host apoptosis
  • Recombinant baculovirus vector resistant to host apoptosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0030] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.

[0031] The anti-apoptosis recombinant baculovirus vector provided by the embodiment of the present invention contains a specific DNA sequence, and the DNA sequence is SEQ ID NO:1.

[0032] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAGTACTGCAGGCTAGGATGCCAGTTGATAGAGCTTATTAATCTATCAACTGGCATCCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant baculovirus vector resistant to host apoptosis, which is an antiapoptosis baculovirus expression vector realized by expressing siRNA of an insect cell caspase-1 through the vector. The baculovirus vector contains a section of special DNA sequence, the section of DNA sequence comprises a U6 promoter and an siRNA sequence of caspase-1 targeted by downstream 21nt thereof. A recombinant virus prepared by utilizing the vector can express double-strand small RNA in a host cell, caspase-1 coded by the host cell is silenced in an RNA interference way, and the apoptosis of the host cell can be further inhibited. The recombinant baculovirus vector can be used for constructing a recombinant baculovirus expressing an exogenous gene; after an insect cell is infected with the obtained recombinant baculovirus, the host apoptosis can be inhibited to remarkably enhance the heterologous protein expression level, thereby reducing the production cost.

Description

technical field [0001] The invention belongs to the technical field of virus vectors, in particular to a recombinant baculovirus vector capable of resisting host apoptosis. Background technique [0002] Baculoviruses are DNA viruses that specifically infect arthropods. Autographa californica polynuclear polyhedrosis virus (AcMNPV) is a type species of baculoviruses. Since Smith et al. transformed baculovirus into an expression system for the first time in 1983, the baculovirus expression system has been widely used in scientific research and production due to the advantages of low cost, high yield, etc., and the expressed protein conformation is close to natural eukaryotic proteins. widely used. [0003] The baculovirus expression system is a transient expression system, and the virus will cause apoptosis and death of insect cells after 3-4 days. The expression time frame of the late promoter-based baculovirus expression system is from 22-24 hours after infection to host c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/866C12N15/66A61K39/00
CPCC12N15/86A61K39/00C12N15/66C12N2710/14034C12N2710/14043
Inventor 许晓东陈红英欧艳梅徐可言
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap