Recombinant baculovirus vector resistant to host apoptosis
A recombinant baculovirus and anti-host technology, applied in the direction of virus/bacteriophage, virus, antibody medical components, etc., can solve the problems that the protein expression level cannot be significantly increased, and the speed and degree of insect cell disease cannot be reduced, etc., to achieve the goal of exogenous protein The effect of increasing expression level, avoiding degradation, and increasing protein expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0029] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0030] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.
[0031] The anti-apoptosis recombinant baculovirus vector provided by the embodiment of the present invention contains a specific DNA sequence, and the DNA sequence is SEQ ID NO:1.
[0032] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAGTACTGCAGGCTAGGATGCCAGTTGATAGAGCTTATTAATCTATCAACTGGCATCCT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com