Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer combination capable of identifying enterovirus type 71 and application of primer combination

A combination of primers and enterovirus technology, applied in the field of biological detection technology, can solve the problems of inapplicable sample on-site detection, unfavorable grass-roots promotion, and high operating requirements for testing personnel.

Inactive Publication Date: 2017-05-10
CAPITALBIO CORP
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR detection methods have been widely used in clinical detection in recent years, such as conventional PCR, RT-PCR, real-time fluorescent quantitative PCR, etc., which play a significant role in the detection of pathogenic microorganisms and disease diagnosis, but generally require instruments capable of precise temperature control It is not suitable for on-site detection of samples, it is not conducive to grass-roots promotion, and it cannot meet the simple, fast and accurate detection requirements for disease prevention and control.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination capable of identifying enterovirus type 71 and application of primer combination
  • Primer combination capable of identifying enterovirus type 71 and application of primer combination
  • Primer combination capable of identifying enterovirus type 71 and application of primer combination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Embodiment 1, primer design and preparation

[0128] A large number of sequence analyzes and comparisons were carried out to obtain several primers for identifying enterovirus 71. Preliminary experiments were carried out on each primer to compare performances such as sensitivity and specificity, and finally three sets of primer combinations for identifying enterovirus 71 were obtained.

[0129] Primer combination I for identifying enterovirus type 71, including a pair of outer primers (F3-1, B3-1), a pair of inner primers (FIP-1, BIP-1) and a pair of loop primers (LF-1, LB-1), each primer sequence is as follows (5'→3'):

[0130] F3-1 (sequence 1 of the sequence listing): GCCAACTGGGACATAGA;

[0131] B3-1 (sequence 2 of the sequence listing): AGGGTCTGACAGCTTGACAA;

[0132] FIP-1 (SEQ ID NO: 3 of the SEQUENCE LISTING): GGTGTGCACGCAACAAAAGTGA-GCGCAAATGCGTAGAAAGG;

[0133] BIP-1 (SEQ ID NO: 4 of the SEQUENCE LISTING): TATGTTTGTGCCACCTGGAGCC-GGGGTTAGTGGCGGTTTG;

[0134] ...

Embodiment 2

[0150] Embodiment 2, primer optimization

[0151] 1. Manually prepare the EV71 armored RNA standard solution, and the RNA sequence is shown in sequence 19 in the sequence table.

[0152] 2. Take the EV71 armored RNA standard solution obtained in step 1, heat it at 95°C for 1min, use the heated RNA standard solution as a template, and use the primer combination I, primer combination II and primer combination III prepared in Example 1 respectively. RT-LAMP amplification.

[0153] When using primer combination I, RT-LAMP amplification reaction system (10 μL): 5 μL Reaction Mix., 0.4 μL Enzyme Mix., 1.09 μL mixed primers, 0.24 μL Eva-Green, 2 μL template RNA, 1.27 μL ddH 2 O. Mixed primers are mixtures of primers in primer combination I. In the reaction system, the final concentration of F3-1 is 0.3 μM, the final concentration of B3-1 is 2 μM, the final concentration of FIP-1 is 2.4 μM, the final concentration of BIP-1 is 2.4 μM, and the final concentration of LF-1 is 1 μM, th...

Embodiment 3

[0158] Embodiment 3, reaction temperature optimization

[0159] 1. Manually prepare the EV71 armored RNA standard solution, and the RNA sequence is shown in sequence 19 in the sequence table.

[0160] 2. Take the EV71 armored RNA standard solution obtained in step 1, heat it at 95° C. for 1 min, use the heated RNA standard solution as a template, and use the primer combination I prepared in Example 1 to perform RT-LAMP amplification.

[0161] RT-LAMP amplification reaction system (10 μL): 5 μL Reaction Mix., 0.4 μL Enzyme Mix., 1.09 μL Mixed Primer, 0.24 μL Eva-Green, 2 μL template RNA, 1.27 μL ddH 2 O. Mixed primers are mixtures of primers in primer combination I. In the reaction system, the final concentration of F3-1 is 0.3 μM, the final concentration of B3-1 is 2 μM, the final concentration of FIP-1 is 2.4 μM, the final concentration of BIP-1 is 2.4 μM, and the final concentration of LF-1 is 1 μM, the final concentration of LB-1 was 1 μM.

[0162] The reaction program ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination capable of identifying enterovirus type 71 and application of the primer combination. The primer combination disclosed by the invention is composed of 6 types of DNA (Deoxyribonucleic Acid) molecules shown as a sequence 1, a sequence 2, a sequence 3, a sequence 4, a sequence 5 and a sequence 6. The primer combination can be used for identifying or assisting to identify whether a virus to be detected is the enterovirus type 71 or not, can also be used for detecting whether a sample to be detected is infected with the enterovirus type 71 or not. A detection method provided by the invention can be used for successfully detecting the enterovirus type 71 without a non-specific reaction with other common respiratory pathogen microorganisms; the detection method is high in accuracy, high in sensitivity and high in specificity.

Description

technical field [0001] The invention relates to the application field of biological detection technology, in particular to a primer combination for identifying enterovirus type 71 and its application. Background technique [0002] Enterovirus 71 (Enterovirus 71, EV71) is a single-stranded positive-sense RNA virus belonging to the Enterovirus genus of the family Picoranviridae, and its capsid protein consists of four types: VP1, VP2, VP3 and VP4. Enterovirus 71 causes hand, foot, and mouth disease (another major cause is Coxsackievirus A16), a common disease in infants and children characterized by fever, mouth sores, and herpes. Individual patients can cause myocarditis, pulmonary edema, aseptic meningoencephalitis and other complications. Enterovirus EV71 infection is a global infectious disease, and it has been reported in most parts of the world. EV71 epidemics occurred in Australia in 1972-1973, 1986 and 1999. In the mid-1970s, Bulgaria and Hungary successively broke ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2521/107C12Q2563/107
Inventor 王亚南王磊邢婉丽陈翔赵丽健程京
Owner CAPITALBIO CORP