Check patentability & draft patents in minutes with Patsnap Eureka AI!

Gene causing internal heat of human bodies in rutaceous plants and application of gene

A plant and rue technology, applied in the direction of plant genetic improvement, application, plant peptides, etc., can solve the problems of affecting citrus consumption, reducing citrus evaluation, and reducing citrus preference

Active Publication Date: 2017-05-24
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Citrus is the most consumed fruit in the world, but the awareness that "eating more oranges will cause anger" often causes people to lower their evaluation of citrus, affects the consumption of citrus, and reduces people's love for citrus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene causing internal heat of human bodies in rutaceous plants and application of gene
  • Gene causing internal heat of human bodies in rutaceous plants and application of gene
  • Gene causing internal heat of human bodies in rutaceous plants and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Protein spectrum analysis and bioinformatic analysis of single substance Cs8g14040 in citrus "upfire"

[0050] 1. Mass spectrometry analysis of a single substance in citrus "lit"

[0051] Mass spectrometry (MS) is currently the most important proteomic identification technology. The basic principle is to separate and determine the molecular weight according to the difference of the ion mass-to-charge ratio (m / z) after the sample molecules are ionized. Nowadays, there are many methods for biological mass spectrometry, among which matrix-assisted laser desorption ionization (MALDI) / time-of-flight mass spectrometry (TOF) and electron spray ionization mass spectrometry (ESI) are the main ones.

[0052]In this experiment, the single component protein of citrus extract (that is, the natural Citsh1 protein that causes human body to get angry) was processed and then detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-M...

Embodiment 2

[0058] Example 2: Cloning the full length of Citsh1 gene and its coding sequence (Coding sequence, CDS)

[0059] Regarding the description of gene naming, the Cs8g14040 homologous gene cloned in Satsuma mandarin in the present invention is named Citsh1, and Cs8g14040.1 corresponds to Citsh1.1, Cs8g14040.2 corresponds to Citsh1.2, and Cs8g14040.3 corresponds to Citsh1.3. Since Citsh1 encodes three transcripts, and the third transcript, Citsh1.3, is the target gene sequence identified by protein spectrum, the Citsh1 used in the follow-up research of the present invention refers to Citsh1.3 unless otherwise specified, which is convenient for unifying the name .

[0060] Embodiment 2 mainly has the following steps:

[0061] 1. Cloning the full length of Citsh1 gene

[0062] 1.1 Extraction of DNA from Wenzhou Satsuma on National Day No. 1

[0063] The young leaves of Wenzhou satsuma were selected and collected from the adult mother trees of the National Citrus Breeding Center of...

Embodiment 3

[0099] Example 3 Construction of Citsh1 gene silencing vector using amiRNA technology

[0100] 1.Molecular design and cloning of amiRNA

[0101] Use the online software WMD3-Web MicroRNA Designer to design amiRNAs targeting the citrus Citsh1 gene. There are two designed amiRNAs, namely amiRNA-1 "TGTTCGTTTAAGCGTTGGCAC" (shown in SEQ ID NO.11) and amiRNA-2 "TAACTTGCAATAGGGTCACCT" (See SEQ ID NO.12), and then obtain amiRNA* and primers I, II, III, and IV for over-lapping PCR (Table 7). Universal primers A and B were paired with the peripheral sequence of MIR319a in pRS300 plasmid respectively.

[0102] Table 7 Construction of overlapping PCR primers for silencing vectors

[0103]

[0104] Using the method of Overlapping PCR (Table 8), A, B, C and D reactions were used to integrate the target fragment into a new DNA fragment (Table 9, 10, 11, 12). The technical route refers to the method provided by WMD3-WebMicroRNA Designer.

[0105] Table 8 Overlapping PCR method

[0106]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene causing internal heat of human bodies in rutaceous plants and an application of the gene in genetic improvement and breeding of the rutaceous plants. The gene causing internal heat of human bodies in rutaceous plants has a nucleotide sequence shown in SEQ ID No.6 or a derived nucleotide sequence which is caused by addition, deficiency or replacement of one or more nucleotides, has the homology not smaller than 80% with the nucleotide sequence shown in SEQ ID No.6 and has the same functions, meanwhile, a corresponding amino acid sequence of the gene is also disclosed. The key gene Citsh1 causing internal heat of human bodies in rutaceous plants (such as citrus) is separated and cloned, a gene silencing carrier is constructed by use of the gene, and genetic breeding improvement is performed on the rutaceous plants through agrobacterium-mediated transformation, so that rutaceous plants which do not cause internal heat of human bodies are cultivated.

Description

technical field [0001] The invention belongs to the interdisciplinary field of plant genetic engineering and human medicine, and more specifically relates to a gene segment of a Rutaceae plant that causes human body to get angry and its application in the genetic improvement and breeding of Rutaceae plants. Background technique [0002] In 2011, China's citrus production ranked first in the world with 3 million tons, and ranked second in China. Wenzhou satsuma, which accounts for a large proportion of citrus, is rich in functional ingredients that can prevent osteoporosis, cancer, and cardiovascular and cerebrovascular diseases[2,6]. Ulcers, dry throat and other "burning" symptoms make people susceptible to irritability and insomnia, affecting people's daily life, thereby affecting the health care and planting benefits of citrus and other fruits. "Shanghuo" is a concept of traditional Chinese medicine, and its symptoms are similar to the Allergy (allergic) reaction studied ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/113C12N15/82A01H5/00
Inventor 马兆成邓秀新吴金龙季群
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More