Type 45 recombinant human papillomavirus virus-like particles and preparation method thereof
A technology of human papillomavirus and HPV45L1, applied in botany equipment and methods, biochemical equipment and methods, antiviral agents, etc., can solve problems such as difficult to apply in large-scale production, large protein loss, uneven particles, etc. , to achieve good immunogenicity and prevent infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment l
[0067] Example 1: Design and synthesis of codon-optimized HPV L1 gene
[0068] The gene sequences are derived from the sequences of various types of HPV that have been published on PUBMED. All HPV DNA sequences were synthesized after codon optimization of selected HPV DNA sequences with reference to the codon preference of E. coli for gene transcription. Primers were designed according to the synthetic DNA sequence, and the synthetic gene was used as a template for PCR amplification. The resulting codon-optimized sequences were verified by DNA sequencing.
[0069] HPV DNA sequences before and after optimization:
[0070] SEQ NO.1: DNA sequence of HPV45 type L1 before optimization
[0071] SEQ NO.2: DNA sequence of optimized HPV45 type L1
Embodiment 2
[0072] Example 2: Construction and identification of recombinant vector pGEX-6P-1-GST-HPV45 L1:
[0073] Primers for amplifying the DNA fragment of HPV45 L1: (the restriction sites are BamHI and XhoI, respectively)
[0074] Forward-HPV45 L1-ApaI: 5' ACTTCAGGATCC ATGGCTCTGTGGCGTCCGTCTG
[0075] Reverse-HPV45 L1-XhoI: 5' ATCTCACTCGAGCTA TTTTTTAGAACGGATACGAAC
[0076] PCR amplification reaction system: 10 x Pfu buffer 20 μL, Pfu enzyme 4 μL, 10 mM dNTP 2.5 μL, 5’ Primer (5 μM) 10 μL, 3’ Primer (5 μM) 10 μL, template DNA 50 ng, plus d 2 H 2 0 to 200 μL.
[0077] Gene PCR amplification conditions: 95°C for 3 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 4 min; cycle 32 times; 72°C for 10 min.
[0078] The L1 gene fragment containing BamH I and XhoI restriction sites and the vector pGEX-6P-1 were subjected to BamH I / XhoI double restriction digestion treatment, and then the recovered gene fragment was combined with pGEX- 6P-1 was ligated at 16 °C for 10-15 h.
[0079] After t...
Embodiment 3
[0081] Example 3: Construction of recombinant vector pGEX-6P-1m-GST-SUMO-HPV45 L1 vector
[0082] Construction of pGEX-6p-1m vector: In order to make the ApaI restriction site (GGGCCC) near the multiple restriction site as the only ApaI restriction site of the vector, without changing the protein expression sequence of the laCl gene, point mutation ApaI (3890) can be eliminated by changing the Gly codon GGC in another ApaI recognition sequence GGGCCC of the commercially available pGEX-6p-1 vector to its synonymous codon GGT. This modification makes ApaI a site for insertion of expressed genes.
[0083] Amplify the DNA fragment primers of SUMO: (the restriction sites are ApaI and BamHI respectively)
[0084] Forward -SUMO-ApaI: ACTTCAGGGCCCCTCTGACCAGGAAGCTAAACCGTC
[0085] Reverse-SUMO-BamHI: CGCGGATCCACCGGTCTGTTCCTGGTAAAC
[0086] Primers for amplifying the DNA fragment of HPV45 L1: (the restriction sites are BamHI and XhoI, respectively)
[0087] Forward-HPV45 L1-ApaI: 5'...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



