Specific cis-acting element, promoter and nucleic acid construct containing the cis-acting element and application thereof
A nucleic acid construct and promoter technology, applied in the field of molecular biology, can solve the problem of few inducible promoters
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1. Preparation of promoter and verification of chitin-specific induced expression
[0049] 1. Preparation of the promoter
[0050] 1. PCR amplification
[0051] Using the genomic DNA of Trichoderma asperellum TD3104 as a template, PCR amplification was performed with 4POS and 4POA primers.
[0052] The primer sequences are as follows:
[0053] 4POS: 5’-AACTCGTTGATTGGGGAGGATAATAGCAG-3’ SEQ ID No: 2
[0054] 4POA: 5'-GGTTATTGGTGATGAAAAGTAATTGGAGAT-3' SEQ ID No: 3
[0055] The reaction system is as follows:
[0056]
[0057] Reaction program: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 45 s; annealing at 54°C for 45 s; extension at 72°C for 60 s, a total of 36 cycles; extension at 72°C for 10 min. After the end, 1% agarose gel electrophoresis was carried out to detect ( figure 1 ), the gel recovered the target product.
[0058] The target product was ligated with the vector pMD18-T, the ligated product was transformed into Escherichia coli,...
Embodiment 3
[0104] Example 3 Identification and analysis of cis-acting elements
[0105] According to the analysis of the core region of the promoter Ptchi2, primer pairs for site-directed base substitution mutation and primer pairs for site-directed base deletion were designed, as shown in Table 2.
[0106] Table 2. List of primers required for site-directed mutagenesis analysis
[0107]
[0108]
[0109] According to the instructions of OneTube Mutagenesis Kit (Beijing Aidelai Biotechnology Co., Ltd.), Pcb302-p1s829-EGFP-Tnos (p1s829 represents the sequence of the 829bp-1042bp region of the Ptchi2 promoter), Pcb302-p1s829-RFP-Tnos (p1s829 represents The sequence of the 829bp-1042bp region of the Ptchi2 promoter) plasmid is a template, and the sequence primer pair in Table 2 is used to carry out PCR amplification. The amplification system is as follows:
[0110]
[0111] The PCR reaction program was pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at...
Embodiment 4
[0115] Example 4 Containing CSICAE Hybrid Promoter Construction and Identification of Inducible Activity
[0116] 1. Construction of Plant Expression Vector Containing CSICAE Hybrid Promoter and Identification of Inducible Activity
[0117] The pROKⅡ plasmid was used as a template, and RH35SS: CGAGCTCACTTGTTCATTACTTGTTCATCGCAAGACCCTTCCTCT SEQ ID No: 28 and RH35SA: GCTCTAGACCCGTGTTTCTCTCAAATGAAATGAACT SEQ ID No: 29 were used as primers to carry out fusion PCR amplification. CSICAE was fused with the cauliflower mosaic virus CaMV35S promoter core sequence, and the amplification system was as follows :
[0118]
[0119] The PCR reaction program was pre-denaturation at 94°C for 5min; denaturation at 94°C for 45s, annealing at 46°C for 45s, extension at 72°C for 20s, and 5 cycles; denaturation at 94°C for 45s, annealing at 53°C for 45s; extension at 72°C for 20s, 30 cycles; Extend for 10 minutes.
[0120] The pROKⅡ plasmid was used as a template, and 35SS: CgagctcCGCAAGACCCTTC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More