Application of T3 DNA ligase and T4 RNA ligase 2 in detection of N6 methyladenine

A technology of methyladenine and ligase, which is applied in the field of biological analysis, can solve the problem of low sensitivity and achieve the effect of high sensitivity, good specificity and simple operation

Active Publication Date: 2017-05-31
SHAANXI NORMAL UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity of this method is low, and it has not been widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of T3 DNA ligase and T4 RNA ligase 2 in detection of N6 methyladenine
  • Application of T3 DNA ligase and T4 RNA ligase 2 in detection of N6 methyladenine
  • Application of T3 DNA ligase and T4 RNA ligase 2 in detection of N6 methyladenine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] T3 DNA ligase in the detection of long non-coding RNA (lncRNA, MALAT1) 2577 m in HeLa cells 6 The application of A content, the detection principle is as follows: figure 1 As shown, the specific detection method is as follows:

[0038] 1. According to the RNA sequence containing the 2577 position of MALAT1 (RNA2577-A) 5'-CUUAAUGUUUUUUGCAUUGG A CUUUGAGUUAAGAUUAUUUUUUAAAUCCUGAGGACUAGCAUUAAUUGAC-3' (the underlined base is the 2577 position, and the 2577 position of MALAT1 in HeLa cells is partly A and partly m 6 A) Design and synthesize the left probe (LigaseL2) and the right probe (Ligase R2), wherein the base sequence of Ligase L2 is 5'-po 4 CCAATGCAAAAA -3' (the underlined part is the detection recognition region, and the italic part is the PCR primer region, provided by Treasure Bioengineering (Dalian) Co., Ltd.), the base sequence of Ligase R2 is 5'- CTTAACTCAAArGrU -3' (The underlined part is the detection recognition region, and the italicized part is the ...

Embodiment 2

[0048]T3 DNA ligase in the detection of long non-coding RNA (lncRNA, MALAT1) 2577 m in HCT116 cells 6 The application of A content, the specific detection method is as follows:

[0049] The probes Ligase L2 and Ligase R2 designed for RNA2577-A in Example 1 were used to detect the content of long non-coding RNA (lncRNA, MALAT1) 2577 site A in HCT116 cells, and the detection method was to use 106ng / μL polyA of HCT116 + RNA replaces poly A of HeLa + RNA, other experimental steps are identical with embodiment 1, and measure its real-time fluorescence curve respectively, and detection result is as follows Image 6 shown. According to the real-time fluorescence curve of RNA2577-A, draw the C for detecting RNA2577-A T Value (the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold value) and the linear relationship curve of the logarithmic value of the RNA2577-A concentration, the results are as follows Figure 7 shown, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of ligase in detection of N6 methyladenine, wherein the ligase is T3 DNA ligase or the T4 RNA ligase 2. The invention firstly discovers that the N6 methyladenine (m6A) can inhibit the connection activity of the T3 DNA ligase and the T4 RNA ligase 2 in comparison with adenine (A), based on the characteristic, the RNA (the RNA containing A and the RNA containing m6A) is taken as a template to establish a method for quantitatively determining the m6A percent content based on the ligase-polymerase chain reaction. The method disclosed by the invention is simple in operation, high in sensitivity and good in specificity, the m6A percent content in each of messenger RNA, long non-coding RNA, ribosome RNA, transfer RNA and small RNA and other RNA can be determined.

Description

technical field [0001] The invention belongs to the technical field of bioanalysis, in particular to two 6 Methyladenine (m 6 A) Sensitive ligase, and the ligation-polymerase chain reaction established based on the ligase to quantitatively detect m in RNA 6 A method of percentage content. Background technique [0002] As antibody-high-throughput sequencing methods develop, scientists reveal m 6 A has important biological functions in living organisms, however m 6 The mechanism of action of A is still unclear. For better research m 6 The mechanism of action of A, the establishment of a specific site m that is simple, fast, sensitive, and has single-base resolution 6 A Analytical detection method is of great significance. [0003] due to m 6 A and adenine (A) have similar chemical structures, precisely positioning m 6 A's position is challenging. currently existing m 6 Most of the analysis methods of A are high-throughput sequencing methods, and most of these method...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/25
Inventor李正平严景丽刘伟亮
OwnerSHAANXI NORMAL UNIV