Fluorescent polarization aptasensor based on dual signal amplification and its application

An aptamer sensor, dual-signal amplification technology, applied in fluorescence/phosphorescence, instruments, scientific instruments, etc., can solve problems such as background signal generation and interference detection, and achieve strong anti-interference, high sensitivity, fast and high throughput The effect of detection

Active Publication Date: 2019-08-06
NANJING UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to provide a novel fluorescence polarization aptasensor based on dual-signal amplification, so as to solve the problems of background signal and interference detection in the fluorescence polarization detection method in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent polarization aptasensor based on dual signal amplification and its application
  • Fluorescent polarization aptasensor based on dual signal amplification and its application
  • Fluorescent polarization aptasensor based on dual signal amplification and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Analysis of the best aptamer truncation sites

[0044] The previously screened aptamer A4SEQ ID NO.16: AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTCTTCCTGCCT was truncated at 15, 25, and 35 bases respectively to obtain three groups of truncated aptamers: DNA-1 (15 bases) and DNA-2 (35 bases ), DNA-3 (25 bases) and DNA-4 (25 bases), DNA-5 (35 bases) and DNA-6 (15 bases). DNA-1, DNA-3 and DNA-5 all modify FITC. Mix 10 μL and 250 μM three groups of cut-off aptamers with 1 μg / mL lactoferrin standard sample respectively, react at 37°C for 30 min, detect with a microplate reader, the excitation wavelength is 480 nm, the emission wavelength is 528 nm, and finally the best cut-off aptamer is obtained. Ligand;

[0045] figure 2 Plot of aptamer fluorescence polarization signal truncated for different base numbers. It can be seen from the figure that the signals of DNA-3 and DNA-4 are the highest, and are significantly higher than that of the complete aptamer Lac-A4, a...

Embodiment 2

[0046] Example 2: Optimization of truncated aptamers

[0047]The obtained truncated aptamer structure was continuously optimized. Three pairs of truncated aptamers: DNA-7 and DNA-8, DNA-9 and DNA-10, DNA-11 and DNA-12 were obtained by removing 3, 5 and 7 hybrid base pairs of the truncated aptamers, respectively. Four groups of 10 μL and 250 μM truncated aptamers were mixed with 90 μL and 1 μg / mL lactoferrin standard samples respectively, reacted at 37°C for 30 min, and detected with a microplate reader.

[0048] image 3 Fluorescence polarization signal plot optimized for truncated aptamer structures. It can be seen from the figure that as the distance between the complementary base pairs of the two truncated aptamers decreases, the fluorescence polarization signal increases gradually, and the signal is the highest when the complementary base pairs are completely removed, and the background also increases with the complementary base The base pair decreased, indicating that ...

Embodiment 3

[0049] Example 3: Dual Binding Site Validation

[0050] Destroy the arm loop structure of the best truncated aptamers DNA-11 and DNA-12 respectively to obtain DNA-13 and DNA-14. Mix 10 μL, 250 μM DNA-13, DNA-14 with 90 μL, 1 μg / mL lactoferrin standard sample , react at 37°C for 30 min, and detect with a microplate reader. Compare the changes in the signal before and after. Afterwards, the two truncated aptamers were labeled with FITC, namely DNA-11 and DNA-15, and the signals generated by them and the signals generated after mixing were compared, and a conclusion was drawn.

[0051] Figure 4 Dual binding site validation fluorescence polarization signal plot. Firstly, when the arm loop structures of DNA-11 and DNA-12 were removed, the signals were significantly reduced, indicating that the arm loop structures of DNA-11 and DNA-12 were very important in binding lactoferrin, and their arm loop structures were The loop structure functions to specifically recognize the protein...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
linear rangeaaaaaaaaaa
linear rangeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a fluorescence polarization aptamer sensor based on double-signal amplification. The fluorescence polarization aptamer sensor comprises a signal generating probe and a capturing probe, wherein nucleotide sequences of the signal generating probe and the capturing probe are shown as SEQ ID NO.1-15. The sensor is used for high sensitively detecting lactoferrin in a homogeneous solution. According to the invention, the structure of the aptamer is optimized under the condition that the affinity and specificity of the aptamer are not changed. In the method, two sections of cut aptamers are used for respectively modifying fluorescein isothiocyanate (FITC) and silver nanoparticle (Ag10NPs); after the lactoferrin is added, the three parts are combined into a cut aptamer-lactoferrin compound; the space distance of Ag10NPs and FITC is shortened; the Ag10NPs can generate weight expansion effect and fluorescence surface enhancing effect and can lastly result in rapid increasing of the fluorescence polarization signal. A result proves that the sensor can reduce the traditional detection limit of the homogeneous solution by three levels and the detection limit can reach up to 1.25pM.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a novel fluorescence polarization aptamer sensor based on double signal amplification and its application. Background technique [0002] Aptamers are functionalized single-stranded DNA or RNA, generally 10-100 bases in length. Aptamers can specifically bind a range of targets, such as small molecules, viruses, proteins, peptides, and viruses. Aptamers that bind to target molecules with high affinity can be obtained from a large number of random libraries by using systematic evolution of ligands by exponential enrichment (SELEX). Compared with traditional antibodies or molecularly imprinted polymers, aptamers have the advantages of easy synthesis, convenient modification, good stability and low price in practical applications. In the presence of target molecules, the aptamer folds into hairpin loops, arm loop structures, G4 conjoined structures and other...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6486
Inventor许丹科李慧陈竹刘晓辉
OwnerNANJING UNIV