A kind of solanum anthocyanin synthesis regulation gene snatcn and its application
A sunflower anthocyanin and gene regulation technology is applied in the fields of application, genetic engineering, plant gene improvement, etc. It can solve the problems of unknown gene sequence, cloning and functional analysis of anthocyanin regulation gene in rare Solanum nigrum
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Target gene cloning and structure prediction and analysis
[0022] 1. Cloning and isolating the conservative sequence of SnATCN gene from Solanum nigrum
[0023] First, SIGMA's TRIZOL REAGENT was used to extract the RNA of Solanum, and then the Solanum cDNA was obtained by reverse transcription with Kangwei Century's HiFiScript cDNA Synthesis kit. The above two steps adopt existing conventional techniques.
[0024] Then use the cDNA as a template, using the degenerate primer Degenerate-F(GAAGT(A / G / T)AG(A / G)AAAGG(A / G / T)CC(A / C)TGGA) (sequence SEQ ID No .6) and Degenerate-R (GACCAGA(A / G / T)(A / G)TC(C / T)TCCAT(A / G)CTCCA) (SEQ ID No.7) to expand the conservative sequence of SnATCN gene The sequence obtained is shown in SEQID No.1.
[0025] The amplification system is as follows: Solanum cDNA 50ng, degenerate primer Degenerate-F / R (10μmol / L) each 1μL, high-fidelity DNA polymerase Lamp (5U / μL) 0.5μL, 2.5mmol / L dNTP mixture 5μL, 10 ×PCR buffer 5μL, add ddH 2 O supplement the s...
Embodiment 2
[0037] Example 2 Analysis of the expression pattern of SnATCN gene at different developmental stages of Solanum nigrum
[0038] 1. The changes of anthocyanin content at different developmental stages of nightshade fruit
[0039] Firstly, collect the solanum fruits at different developmental stages, namely, the green, turn, purple, and mature stages of solanum fruit ( figure 2 A from left to right), and then detect the anthocyanin content in the peel by HPLC. The HPLC detection conditions are as follows: Agilent 1200 high performance liquid chromatograph, C18 (SB-C18 4.6×250mm) column, detection wavelength It is 520nm, and the column oven temperature is 30°C. The mobile phase and elution gradient are as follows: mobile phase A is composed of 87% water, 3% acetonitrile and 10% formic acid; mobile phase B is composed of 40% water, 50% acetonitrile and 10% formic acid; elution The gradient is as follows: 0 min 4% B, 20 min 20% B, 35 min 40% B, 40 min 60% B, 45 min 90% B, 55 min 4% B,...
Embodiment 3
[0048] Example 3 Construction of the transient expression vector of the anthocyanin synthesis regulating gene SnATCN in Solanum nigrum
[0049] Using our designed target gene transient expression vector primer SnATCN-PGR-F (CCATCGATATGAATACTCCTATAATGTGTACGTCG) sequence is shown in SEQ ID No. 16, and SnATCN-PGR-R (TTGCGGCCGCTTAATTAAGTAGATTCCATAGGTCAAT) sequence is shown in SEQ ID No. 17, and the current After some conventional vector construction techniques, the transient expression vector of the target gene was successfully obtained.
[0050] The specific construction steps of the pGR106 transient expression vector used are as follows: use the above primers SnATCN-PGR-F and SnATCN-PGR-R to amplify the target DNA fragment, digest by ClaI and NotI, purify it by ethanol precipitation, and use it with The pGR106 vector treated with the same enzyme was ligated, and the ligation system was as follows: pGR106 vector 1uL, ligase Buffer 1uL, T4DNA ligase 0.3uL, target gene recovery fragment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More