Nightshade anthocyanin synthesis regulation gene SnATCN and application thereof
A sunflower anthocyanin and gene regulation technology is applied in the fields of application, genetic engineering, plant gene improvement, etc. It can solve the problems of cloning and functional analysis of anthocyanin regulation genes in solanum nigrum, and unknown gene sequences.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Target gene cloning and structure prediction and analysis
[0022] 1. Clone and isolate the conserved sequence of the SnATCN gene from Solanum nigrum
[0023] First, TRIZOL REAGENT of SIGMA Company was used to extract the RNA of Solanum nigrum, and then the HiFiScript cDNA Synthesis kit of Kangwei Century Company was used to reverse transcribe to obtain Solanum nigrum cDNA. The above two steps all adopt the existing conventional technology.
[0024] Using the cDNA as a template, the degenerate primer Degenerate-F (GAAGT (A / G / T) AG (A / G) AAAGG (A / G / T) CC (A / C) TGGA) (sequence SEQ ID No .6) and Degenerate-R (GACCAGA (A / G / T) (A / G) TC (C / T) TCCAT (A / G) CTCCA) (sequence SEQ ID No.7) carry out the amplification of SnATCN gene conservative sequence increase, the obtained sequence is shown in SEQID No.1.
[0025]The amplification system was as follows: Solanum solanum cDNA 50ng, degenerate primer Degenerate-F / R (10μmol / L) 1μL each, high-fidelity DNA polymerase Lamp ...
Embodiment 2
[0037] Example 2 Analysis of the expression pattern of SnATCN gene in different developmental stages of Solanum nigrum fruit
[0038] 1. Changes of anthocyanin content in Solanum nigrum fruit at different developmental stages
[0039] Firstly, Solanum nigrum fruits of different developmental stages were collected, namely green fruit stage (Green), discoloration stage (Turn), purple stage (Purple), and mature stage (Mature) ( figure 2 A from left to right), and then detect the anthocyanin content in the pericarp by HPLC, and the HPLC detection conditions are as follows: adopt 1200 high performance liquid chromatography of Agilent Company, the chromatographic column of C18 (SB-C18 4.6 * 250mm), the detection wavelength is 520nm, and the temperature of the column oven is 30°C. The mobile phase and elution gradient are as follows: mobile phase A is composed of 87% water by volume, 3% acetonitrile and 10% formic acid; mobile phase B is composed of 40% water by volume, 50% acetoni...
Embodiment 3
[0048] Example 3 Construction of Transient Expression Vector of the Anthocyanin Synthesis Regulation Gene SnATCN in Solanum nigrum
[0049] Utilizing our designed target gene transient expression vector primer SnATCN-PGR-F (CCATCGATATGAATACTCCTATAATGTGTACGTCG) sequence as shown in SEQ ID No.16, and SnATCN-PGR-R (TTGCGGCCGCTTAATTAAGTAGATTCCATAGGTCAAT) sequence as shown in SEQ ID No.17, and using the present After some conventional vector construction techniques, the transient expression vector of the target gene was successfully obtained.
[0050] The specific construction steps of the pGR106 transient expression vector used are as follows: use the above-mentioned primers SnATCN-PGR-F and SnATCN-PGR-R to amplify the target DNA fragment, use ethanol precipitation to purify and recover after ClaI and NotI double enzyme digestion, and use The same enzyme-treated pGR106 vector was ligated, and the ligation system was as follows: pGR106 vector 1uL, ligase Buffer 1uL, T4DNA ligase 0....
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


