Unlock instant, AI-driven research and patent intelligence for your innovation.

Nightshade anthocyanin synthesis regulation gene SnATCN and application thereof

A sunflower anthocyanin and gene regulation technology is applied in the fields of application, genetic engineering, plant gene improvement, etc. It can solve the problems of cloning and functional analysis of anthocyanin regulation genes in solanum nigrum, and unknown gene sequences.

Active Publication Date: 2017-06-09
SHANDONG AGRICULTURAL UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Isolation and cloning of anthocyanin synthesis regulatory genes is a prerequisite for the study of anthocyanin synthesis mechanism in Solanum nigrum, but because the genome sequencing of Solanum nigrum has not been completed and its gene sequence is unknown, it will be difficult to clone and isolate genes from it. Therefore, few studies have reported on the cloning and functional analysis of anthocyanin-related regulatory genes in Solanum nigrum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nightshade anthocyanin synthesis regulation gene SnATCN and application thereof
  • Nightshade anthocyanin synthesis regulation gene SnATCN and application thereof
  • Nightshade anthocyanin synthesis regulation gene SnATCN and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Target gene cloning and structure prediction and analysis

[0022] 1. Clone and isolate the conserved sequence of the SnATCN gene from Solanum nigrum

[0023] First, TRIZOL REAGENT of SIGMA Company was used to extract the RNA of Solanum nigrum, and then the HiFiScript cDNA Synthesis kit of Kangwei Century Company was used to reverse transcribe to obtain Solanum nigrum cDNA. The above two steps all adopt the existing conventional technology.

[0024] Using the cDNA as a template, the degenerate primer Degenerate-F (GAAGT (A / G / T) AG (A / G) AAAGG (A / G / T) CC (A / C) TGGA) (sequence SEQ ID No .6) and Degenerate-R (GACCAGA (A / G / T) (A / G) TC (C / T) TCCAT (A / G) CTCCA) (sequence SEQ ID No.7) carry out the amplification of SnATCN gene conservative sequence increase, the obtained sequence is shown in SEQID No.1.

[0025]The amplification system was as follows: Solanum solanum cDNA 50ng, degenerate primer Degenerate-F / R (10μmol / L) 1μL each, high-fidelity DNA polymerase Lamp ...

Embodiment 2

[0037] Example 2 Analysis of the expression pattern of SnATCN gene in different developmental stages of Solanum nigrum fruit

[0038] 1. Changes of anthocyanin content in Solanum nigrum fruit at different developmental stages

[0039] Firstly, Solanum nigrum fruits of different developmental stages were collected, namely green fruit stage (Green), discoloration stage (Turn), purple stage (Purple), and mature stage (Mature) ( figure 2 A from left to right), and then detect the anthocyanin content in the pericarp by HPLC, and the HPLC detection conditions are as follows: adopt 1200 high performance liquid chromatography of Agilent Company, the chromatographic column of C18 (SB-C18 4.6 * 250mm), the detection wavelength is 520nm, and the temperature of the column oven is 30°C. The mobile phase and elution gradient are as follows: mobile phase A is composed of 87% water by volume, 3% acetonitrile and 10% formic acid; mobile phase B is composed of 40% water by volume, 50% acetoni...

Embodiment 3

[0048] Example 3 Construction of Transient Expression Vector of the Anthocyanin Synthesis Regulation Gene SnATCN in Solanum nigrum

[0049] Utilizing our designed target gene transient expression vector primer SnATCN-PGR-F (CCATCGATATGAATACTCCTATAATGTGTACGTCG) sequence as shown in SEQ ID No.16, and SnATCN-PGR-R (TTGCGGCCGCTTAATTAAGTAGATTCCATAGGTCAAT) sequence as shown in SEQ ID No.17, and using the present After some conventional vector construction techniques, the transient expression vector of the target gene was successfully obtained.

[0050] The specific construction steps of the pGR106 transient expression vector used are as follows: use the above-mentioned primers SnATCN-PGR-F and SnATCN-PGR-R to amplify the target DNA fragment, use ethanol precipitation to purify and recover after ClaI and NotI double enzyme digestion, and use The same enzyme-treated pGR106 vector was ligated, and the ligation system was as follows: pGR106 vector 1uL, ligase Buffer 1uL, T4DNA ligase 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plant genetic engineering, and provides a nightshade anthocyanin synthesis regulation gene SnATCN and application thereof. The nucleotide sequence of the gene is as shown in SEQ ID No. 4, and an amino acid sequence encoded by the gene is as shown in SEQ ID No. 5. The inventor designs a degenerate primer to amplify conserved areas of the SnATCN gene, and a full-length DNA (Deoxyribonucleic Acid) sequence of the SnATCN gene is obtained from nightshade cDNA through amplification by using an RACE-PCR (Rapid-Amplification of cDNA Ends-Polymerase Chain Reaction) method; meanwhile tests show that the content of anthocyanin of nightshade fruit in different development periods is in positive correlation with expression of the SnATCN gene, the SnATCN gene is finally in transient expression in tobacco, results show that synthesis of the anthocyanin in tobacco can be excited, and finally a positive regulation function of the SnATCN gene upon synthesis of the anthocyanin can be demonstrated.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to a Solanum solanum anthocyanin synthesis regulating gene SnATCN and an application thereof. Background technique [0002] As a water-soluble pigment widely present in plants, anthocyanins belong to flavonoids and exist in 72 genera of flowering plants in 27 families (Sarma et al., 1997). As a natural pigment, anthocyanins are water-soluble and can impart purple, blue and red colors to many flowers and fruits, and can promote pollination and seed dispersal (Shang et al., 2011). Many studies have confirmed that natural anthocyanins can protect plants from some biotic and abiotic stresses (Ballaré et al., 2003). In addition, a diet rich in anthocyanins has obvious health care functions for human health. Anthocyanins have the effect of treating certain chronic diseases such as hyperglycemia and inhibiting the growth of tumor cells, as well as improving vision. [...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415A01H5/00
CPCC07K14/415C12N15/8205C12N15/825
Inventor 丁新华汪少丽储昭辉贾茹赵长宝
Owner SHANDONG AGRICULTURAL UNIVERSITY