Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Goat CDK2 (Cyclin-dependent kinases 2) gene knockout vector and construction method thereof

A gene knockout and construction method technology, which is applied in the field of genetic engineering, can solve the problems of loss of target gene function, long construction and assembly time, and difficult construction technology. The method is simple and fast, improves gene knockout efficiency, and reduces off-target effects Effect

Inactive Publication Date: 2017-06-13
INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE ANHUI ACAD OF AGRI SCI
View PDF0 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, ZFNs or TALENs are used for gene knockout. To edit each gene site, two nucleases need to be designed and assembled. The construction technology is difficult and the construction and assembly time is relatively long.
In addition, traditional gene knockout mainly uses the principle of gene recombination to lose the function of the target gene through insertion mutation and targeting technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Goat CDK2 (Cyclin-dependent kinases 2) gene knockout vector and construction method thereof
  • Goat CDK2 (Cyclin-dependent kinases 2) gene knockout vector and construction method thereof
  • Goat CDK2 (Cyclin-dependent kinases 2) gene knockout vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0047] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0048] The application principle of the present invention will be further described below in conjunction with the accompanying drawings.

[0049] A kind of goat CDK2 gene knockout carrier provided by the present invention, the sgRNA nucleotide sequence of the goat CDK2 gene knockout carrier is:

[0050] SEQ ID NO1: CDK2-gRNA-Lg1: TTCTCCCGTCAACTTGTTTTTGG;

[0051] SEQ ID NO 2: CDK2-gRNA-Rg1: GGCGCTTAAAAAAATCCGCCTGG.

[0052] A plasmid PYSY-sgRNA expressing sgRNA nucleotides,

[0053] The plasmid PYSY-sgRNA is:

[0054] pYSY-CMV-Cas9n-U6-CDK2-gRNA-L2-SV40-Neo plasmid and

[0055] pYSY-CMV-Cas9n-U6-CDK2-gRNA-R2-EF1a-eGFP pl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a goat CDK2 (Cyclin-dependent kinases 2) gene knockout vector and a construction method thereof. A CRISPR / Cas9 system is adopted; an SgRNA segment of a CDK2 gene is designed at first and an SgRNA nucleotide sequence is synthesized; a plasmid PYSY-sgRNA for expressing SgRNA and Cas9D10A at the same time is constructed; the plasmid PYSY-sgRNA is connected and transformed to an escherichia coli DH5alpha competent cell; finally, a transformant is verified; restriction enzyme digestion and sequencing identification prove that the construction of the CDK2 gene knockout vector is accurate. The vector constructed by CRISPR / Cas9 is adopted, and a theoretical basis is provided for subsequently obtaining a goat CDK2 gene deletion type cell line and researching a molecular mechanism of cell apoptosis molecules triggered by mycoplasma pneumonia infection.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a goat CDK2 gene knockout vector and a construction method thereof. Background technique [0002] The drive of CDKs can complete cell cyclin-dependent protein kinase-2 (Cyclin-dependentkinases 2, CDK 2) is one of the family members of CDK. The biological function of CDK2 is mainly involved in cell cycle regulation, which can be activated by cyclin E (cyclin E) and cyclin A (cyclin A) at different stages of the cell cycle, thereby promoting the transcription of a series of cell cycle-related genes , the dual role of initiating DNA replication and inducing mitosis. [0003] The CRISPR / Cas9 system is one of the immune mechanisms that bacteria have evolved under the long-term selection pressure of phages to effectively resist the invasion of foreign DNA. In bacteria, the CRISPR cluster is transcribed into precrRNA under the control of its leader region, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/11C12N15/113
CPCC12N15/85C12N15/1137C12N2310/10C12N2800/107C12N2800/80
Inventor 惠文巧陈胜汤继顺班谦
Owner INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products