Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting pasteurella multocida in environmental aerosol sample, and application of kit

A Pasteurella, detection environment technology, applied in the field of microbial detection, can solve the problems of high sensitivity requirements of detection methods, difficulty in collecting aerosol samples, low bacteria, etc., and achieves the effect of low cost, accuracy and practicability

Inactive Publication Date: 2017-06-13
SHANDONG NORMAL UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low content of bacteria in the Pasteurella multocida aerosol, the sensitivity of the detection method is very high, and the collection of aerosol samples is relatively difficult. Related reports on the detection of aerosols using TaqMan technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting pasteurella multocida in environmental aerosol sample, and application of kit
  • Kit for detecting pasteurella multocida in environmental aerosol sample, and application of kit
  • Kit for detecting pasteurella multocida in environmental aerosol sample, and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Design of primers and probes

[0060] Referring to the Kmt1 gene specific to Pasteurella multocida in GeneBank (GengBank No.AF016259), two pairs of specific primers and probes were designed using Primer Express 3.0 software. The specific sequences are shown in Table 1. When designing the primers, the conservation of the Kmt1 gene in the primer design region was firstly BLASTed on the Genebank data, all of which matched 100% with Pasteurella multocida strains. Then BLAST comparison was performed on the designed upstream and downstream primers and probes, and it was found that none of them matched with other gene sequences, which ensured the specificity of the primer sequences. A pair of optimal primers (shown in SEQ ID NO.1 and SEQ ID NO.2) and probe (shown in SEQ ID NO.3) were screened through pre-experimentation, synthesized by Huada Gene, and expected to amplify DNA product 101bp.

[0061] Table 1 Pasteurella multocida specific primer pairs and probe sequ...

Embodiment 2

[0063] Example 2: Establishment of a method for detecting Pasteurella multocida in environmental aerosol samples and investigation on the sensitivity and specificity of the detection method

[0064] 1. Amplification of a partial fragment of the Kmt1 gene of Pasteurella multocida

[0065] Using Pasteurella multocida positive disease DNA as a template, apply upstream primer Pm-F: 5'-TTGGTGTGTTGAGCCAATCTG-3' (shown in SEQ ID NO.1) and downstream primer Mb-241-R: 5'-ATTAAACCGTTGGAACACGAAGA -3' for amplification. The reaction system is 50 μL: 10×LA PCR Buffer II (Mg 2+Plus) 5 μL, 2.5mM dNTP Mixture 8 μL, LA Taq 0.5 μL (5U / μL), template 2 μL, 10 μmol / L upstream and downstream primers 1 μL, sterilized ultrapure water 32.5 μL. The reaction program was pre-denaturation at 94°C for 3 min, followed by 30 cycles at 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s, and a total of 32 cycles; extension at 72°C for 10 min, and finally stopped at 4°C. The PCR products were identified by agar...

Embodiment 3

[0084] Embodiment 3: The kit that is used for the detection of Pasteurella multocida

[0085] The composition of kit: the primer and probe combination that embodiment 1 designs, positive standard plasmid, negative control and real-time fluorescence quantitative PCR (qPCR) reagent (commercial product, conventional kit in the prior art);

[0086] The positive standard plasmid consists of the pEASY-T3 recombinant plasmid consisting of a nucleotide fragment as shown in SEQ ID No.4 (241 bases); the details are as follows:

[0087] 5'-TTGGTGTGTTGAGCCAATCTGCTTCCTTGACAACGGCGCAACTGATTGGACGTTATTTTATTACTCAGCTTATTGTTATTTGCCGGTTTATATTTCCCTTGTCAGTCTGATTTATCAATATTTCCCATGTTGAGTTACGTTTCTTATGGCCATTATTGAAGCCATTAACGACAGAGCGGTTTAATTTATTTTATCGTGTATTGGTTACTATTTTGGTCTTTTACTCGT'(

[0088] The negative control is pEASY-Y3 empty plasmid standard

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and probe combination for detecting pasteurella multocida in an environmental aerosol sample. The primer and probe combination is characterized by comprising a positive primer, a negative primer and a probe, wherein the sequence of the positive primer is as shown in SEQ ID NO.1, the sequence of the negative primer is as shown in SEQ ID NO.2, and the sequence of the probe is as shown in SEQ ID NO.3. The invention also discloses a kit for detecting the pasteurella multocida in the environmental aerosol sample. The content and the distribution condition of the pasteurella multocida in the environmental aerosol sample are subjected to real-time fluorescence quantitative PCR detection by using TaqMan, the occurrence risk of pasteurellosis is predicted, and reference is provided for determination of selection, use times and key disinfection areas of sanitary disinfection reagents of a field area.

Description

technical field [0001] The invention relates to the technical field of microorganism detection, in particular to a kit and application for detecting Pasteurella multocida in environmental aerosol samples. Background technique [0002] Pasteurella mutocida (Pm) is a Gram-negative pathogen that causes a variety of pasteurellosis in livestock and poultry. It generally parasitizes the upper respiratory tract of animals and is conditionally pathogenic. Under the condition, it can cause hemorrhagic septicemia or respiratory system disease in carrier animals. Among domestic animals, cattle, pigs, rabbits, and sheep are more frequently affected, and goats, deer, camels, horses, donkeys, dogs, cats, and minks can also be infected. Among poultry, chicken, turkey and duck are most susceptible, followed by geese and pigeon. According to the specificity of capsular antigen, Pm can be divided into five serotypes (A, B, D, E, F). In my country, the main pathogen that causes pasteurellos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/01
CPCC12Q1/689C12Q1/6851C12Q2531/113C12Q2545/113C12Q2561/101
Inventor 何洪彬赵贵民侯佩莉王洪梅
Owner SHANDONG NORMAL UNIV