A visualized miRNA detecting method by utilizing an exonuclease reaction to generate primers and dendritic rolling circle amplification

An exonuclease, rolling circle amplification technology, applied in the fields of molecular biology and nucleic acid chemistry, can solve the problems of poor ability to distinguish homologous sequences, large sample volume, complex primer design, etc., to avoid background signal interference, The effect of improving selectivity

Active Publication Date: 2017-06-20
WUHAN UNIV
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some current methods for miRNA detection, such as the traditional northern blot method, require large sample volumes, long detection cycles, and poor ability to distinguish homologous sequences, which limits further applications
Some emerging methods based on nanoparticles and electrochemical detection methods have solved the problem of detection limit very well, but for the production of nanoparticles and electrochemical substrates, skilled professionals are required, and it is not easy to popularize and apply this method. RT -PCR method successfully solves the above problems, with high sensitivity, can detect RNA as low as 1-10ng, and the detection range is as high as 7 orders of magnitude, can detect low or high concentration miRNA, and can distinguish homologs very well sequence
However, complex primer design and expensive real-time fluorescence quantitative PCR instruments limit the popularization and application of RT-PCR to a certain extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A visualized miRNA detecting method by utilizing an exonuclease reaction to generate primers and dendritic rolling circle amplification
  • A visualized miRNA detecting method by utilizing an exonuclease reaction to generate primers and dendritic rolling circle amplification
  • A visualized miRNA detecting method by utilizing an exonuclease reaction to generate primers and dendritic rolling circle amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] In this example, miRNA21 (sequence 5'-UAGCUUAUCAG ACUGAUGUUGA-3') was used as the detection target.

[0030] 1. Design and synthesis of hairpin probe I, phosphorylated long single-stranded DNA and hairpin probe II

[0031] (1) The I sequence of the hairpin probe is:

[0032] 5'- CCCAACCCATCAACATCAGTCTGATAAGCTA TTACTAG TGGGTTGGG -3'.

[0033] Among them, the underlined sequence can be complementary paired to form a "stem", and the rest form a loop, and the double underlined sequence can be complementary paired with miRNA21 so that the hairpin probe I is opened.

[0034] After hairpin probe I and miRNA21 are complementary paired, they are degraded by exonuclease I and ribonuclease H to obtain a short single-stranded DNA whose sequence is CCCAACCCA TCAACATCAGT CTGATAAGCTA.

[0035] (2) The sequence of the phosphorylated long single-stranded DNA probe is:

[0036] 5'-PO 4 - ACTGATGTTGACAGGAATTAGTAAACAATGAAGACCCAACCCGCCCTACCCTAGCTTATCAG -3'.

[0037] Among them, ...

Embodiment 2

[0058] In this example, miRNA155 is used as the detection target, and the detection method is the same as in Example 1, and the probe sequences used are as follows:

[0059] Hairpin probe I: 5'-CCCAACCCA ACCCCTATCACGATTAGCATTAA TTACTAG TGGGTTGGG-3';

[0060] Phosphorylated long single-stranded DNA probe: 5'-PO 4 - GTGATAGGGGT CAGGAATTAGTAAACAATGAAGACCCAACCCGCCCTACCC TTAATGCTAATC-3';

[0061] Hairpin Probe II: TTAATGCTAATC CAGGAATTAGTAAACAATGAAGA ACCCCTATCAC GATTAGCATTAA.

[0062] The result is as Figure 4 , as the concentration of miRNA155 increased, the UV absorption gradually increased. It shows that by changing the probe sequence, the method of the present invention is suitable for detecting other miRNAs.

Embodiment 3

[0064] According to the probe and method in Example 1, the total RNA extracted from the human cervical cancer cell line Hela cells was detected. The amounts of total RNA used were 0.5 μg and 5 μg, respectively. see results Figure 5 , as the amount of total RNA added increases, the UV absorbance value increases.

[0065] The above-mentioned embodiment is a preferred embodiment of the present invention, but the embodiment of the present invention is not limited by the above-mentioned embodiment, and any other changes, modifications, substitutions, combinations, Simplifications should be equivalent replacement methods, and all are included in the protection scope of the present invention.

[0066] SEQUENCE LISTING

[0067] Wuhan University

[0068] A method for visual detection of miRNA using exonuclease reaction to generate primers combined with dendritic rolling circle amplification

[0069] method

[0070] 1

[0071] 6

[0072] PatentIn version 3.3

[0073] 1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A visualized miRNA detecting method by utilizing an exonuclease reaction to generate primers and dendritic rolling circle amplification is disclosed. The method includes three steps. The first step is a step of primer generation, wherein after a hairpin-structured probe I is opened by a target miRNA, a single-chain part is degraded by an exonuclease I, and then RNA in a DNA:RNA hybrid chain is degraded by ribonuclease H to leave a short-chain DNA segment. The second step is a step of dendritic rolling circle amplification, wherein the single-chain DNA generated in the former step is connected to a long single-chain DNA probe to form a ring adopted as a template, first-stage rolling circle amplification is performed by adopting the single-chain DNA as a primer, and a hairpin-structured stem-loop structure II introduced into a rolling circle amplification system is opened by a product of the first-stage rolling circle amplification, thus performing multi-stage dendritic rolling circle amplification. The third step is a step of performing detection based on a G-quadruplex in a product of the rolling circle amplification. The method is a sensitive, economical, convenient and in-situ visualized miRNA detecting method.

Description

technical field [0001] The invention belongs to the fields of molecular biology and nucleic acid chemistry, and relates to a method for visually detecting miRNA by using exonuclease reaction to generate primers combined with dendritic rolling circle amplification. Background technique [0002] MicroRNA (miRNA) is a kind of endogenous, non-coding small RNA with a length of about 20-24 nucleotides, which has a variety of important regulatory functions in cells. Mature miRNAs have a phosphate group at the 5' end and a hydroxyl group at the 3' end. miRNA genes are usually transcribed by nuclear RNA polymerase II, and the initial product is a large pri-miRNA with a cap structure and a polyA tail, which is then processed into a 60-70 base hairpin by Drosha in the nucleus The pre-RNA is transported into the cytoplasm by the transport protein Exprotin-5 complex, and then recognized and cleaved by Dicer enzyme to form mature miRNA. It is assumed that miRNAs regulate one-third of hu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/6886C12Q2600/158C12Q2600/178C12Q2531/125C12Q2521/319
Inventor周翔刘奕侬王少儒田沺张小娥黄俊捷杨伊文朱子睿
OwnerWUHAN UNIV