Supercharge Your Innovation With Domain-Expert AI Agents!

LAMP (loop-mediated isothermal amplification) kit for detecting ST-II enterotoxigenic Escherichia coli and application method thereof

A detection kit, Escherichia coli technology, applied in the field of LAMP detection kit for rapid detection of enterotoxigenic E. Detection effect

Inactive Publication Date: 2017-07-21
JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR detection technology has high sensitivity and strong specificity, and has become one of the important technologies for pathogen detection, mainly including conventional PCR, nested PCR, and real-time fluorescent quantitative PCR, etc., but this technology needs to rely on expensive PCR equipment, which is not conducive to grassroots Promotion and application in production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop-mediated isothermal amplification) kit for detecting ST-II enterotoxigenic Escherichia coli and application method thereof
  • LAMP (loop-mediated isothermal amplification) kit for detecting ST-II enterotoxigenic Escherichia coli and application method thereof
  • LAMP (loop-mediated isothermal amplification) kit for detecting ST-II enterotoxigenic Escherichia coli and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The design of embodiment 1 LAMP primer

[0044] Enterotoxigenic Escherichia coli heat-resistant enterotoxin ST-II gene sequence was retrieved from GenBank, and homology comparison analysis was performed by MegAlign software to obtain a conserved sequence of ST-II toxin gene SEQ NO.1, which was designed using PrimerExplorer V4 software 4 specific LAMP detection primers, including forward outer primer F3, reverse outer primer B3, forward inner primer FIP and reverse inner primer BIP, the primer sequences are:

[0045] Forward outer primer F3: 5'- GCAATAAGGTTGAGGTGATT -3';

[0046] Reverse outer primer B3: 5'- GCAACCATTATTTGGGCG -3';

[0047] Forward internal primer FIP: 5'- TGATTGTGTAGATGCATAGGCATTTTTCTTCTTGCATCTATGTTCG-3;

[0048] Reverse inner primer BIP: 5'- TAGACAAATAGCCAAGGAAAGTTGTTGCTCCAGCAGTACCATC -3;

Embodiment 2

[0049] Embodiment 2 Configuration of LAMP detection kit

[0050] (1) Reaction solution I (23 μL): 2.5 μL of 10× Thermopol buffer; 4 μL of 10 mM dNTPs; 1 μL of 25 mM MgCl2; 0.6 μL of 8U / uL Bst DNase; 0.5 μL of 10 μM forward outer primer F3; Outward primer B3 0.5 μL; 10 μM forward internal primer FIP 2 μL; 10 μM reverse internal primer BIP 2 μL, sterilized ultrapure water 9.9 μL. ;

[0051] (2) Positive DNA (2 μL): DNA of the sample to be tested;

[0052] (3) Chromogenic solution (1 μL): SYBR Green I.

Embodiment 3

[0053] Example 3 Method of using the LAMP detection kit for ST-II type enterotoxigenic Escherichia coli

[0054] (a) DNA extraction: Extract DNA by boiling method, take 1mL of bacterial culture, centrifuge at 12000r / min for 5min; add 100μL of ultrapure water, mix well, boil at 100°C, quickly transfer to -20°C to freeze for 5min, then 4°C Centrifuge at 12000r / min for 5min. Take the supernatant, which is the DNA in the sample to be tested;

[0055] (b) LAMP amplification: Prepare 23 μL reaction solution , take 2μL of the sample DNA to be tested and the reaction solution Mix well to form a 25μL reaction system; take 1μL SYBR Green Add dropwise to the inside of the cap of the reaction tube, and operate carefully to prevent the dye from falling into the reaction system; place the reaction tube in a constant temperature water bath at 60°C to 63°C for 45 minutes for LAMP amplification, and heat at 85°C for 5 minutes to inactivate the activity of the enzyme;

[0056] (c) Take o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a LAMP (loop-mediated isothermal amplification) kit for detecting ST-II (heat-stable enterotoxin type II) enterotoxigenic Escherichia coli and an application method thereof and belongs to the technical field of detection of pathogenic microorganisms. The kit comprises 4 primers, including forward outer primer F3, backward outer primer B3, forward inner primer FIP and backward inner primer BIP. The kit of the invention can efficiently and specifically detect SK-II enterotoxigenic Escherichia coli just by constant-temperature water bath reaction at 60-63 DEG for 45 min. The kit may reach 500 fg / MuL in sensitivity, the sensitivity is 1000 times of that of conventional PCR (polymerase chain reaction), and has the advantages of high specificity, high sensitivity, good operational simplicity, good judging simplicity, low cost and the like, can well satisfy in-situ detection of ST-II enterotoxigenic Escherichia coli, and a novel platform is provided for the field detection of farm epidemic diseases.

Description

technical field [0001] The invention relates to the technical field of pathogenic microorganism detection, in particular to a LAMP detection kit for rapidly detecting enterotoxigenic Escherichia coli ST-II toxin. Background technique [0002] Escherichia coli is the most common type of bacteria in the gut. According to its pathogenicity, it can be roughly divided into: Enteropathogenic E. coli (EPEC), invasive E. coli (Enteroinvasive E. coli, EIEC), toxigenic E. coli (Enterotoxigenic E. coli, ETEC), enterohemorrhagic E.coli (Enterohemorrhagic E.coli, EHEC / STEC) and adhesive Escherichia coli (EnteroaggregativeE.coli, EAEC). Among them, ETEC can produce heat labile enterotoxin (LT) and heat stable enterotoxin (ST), which can cause severe diarrhea in humans or livestock. [0003] At present, there are traditional detection methods and genetic detection methods for the detection of enterotoxigenic E. coli. [0004] Traditional detection methods mainly rely on physiological ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12R1/19
CPCC12Q1/6844C12Q1/689C12Q2531/119
Inventor 朱善元成大荣吴双蔡树东左伟勇王安平王永娟郭长鸣洪伟鸣秦枫
Owner JIANGSU AGRI ANIMAL HUSBANDRY VOCATIONAL COLLEGE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More