LAMP (loop-mediated isothermal amplification) kit for detecting ST-II enterotoxigenic Escherichia coli and application method thereof
A detection kit, Escherichia coli technology, applied in the field of LAMP detection kit for rapid detection of enterotoxigenic E. Detection effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] The design of embodiment 1 LAMP primer
[0044] Enterotoxigenic Escherichia coli heat-resistant enterotoxin ST-II gene sequence was retrieved from GenBank, and homology comparison analysis was performed by MegAlign software to obtain a conserved sequence of ST-II toxin gene SEQ NO.1, which was designed using PrimerExplorer V4 software 4 specific LAMP detection primers, including forward outer primer F3, reverse outer primer B3, forward inner primer FIP and reverse inner primer BIP, the primer sequences are:
[0045] Forward outer primer F3: 5'- GCAATAAGGTTGAGGTGATT -3';
[0046] Reverse outer primer B3: 5'- GCAACCATTATTTGGGCG -3';
[0047] Forward internal primer FIP: 5'- TGATTGTGTAGATGCATAGGCATTTTTCTTCTTGCATCTATGTTCG-3;
[0048] Reverse inner primer BIP: 5'- TAGACAAATAGCCAAGGAAAGTTGTTGCTCCAGCAGTACCATC -3;
Embodiment 2
[0049] Embodiment 2 Configuration of LAMP detection kit
[0050] (1) Reaction solution I (23 μL): 2.5 μL of 10× Thermopol buffer; 4 μL of 10 mM dNTPs; 1 μL of 25 mM MgCl2; 0.6 μL of 8U / uL Bst DNase; 0.5 μL of 10 μM forward outer primer F3; Outward primer B3 0.5 μL; 10 μM forward internal primer FIP 2 μL; 10 μM reverse internal primer BIP 2 μL, sterilized ultrapure water 9.9 μL. ;
[0051] (2) Positive DNA (2 μL): DNA of the sample to be tested;
[0052] (3) Chromogenic solution (1 μL): SYBR Green I.
Embodiment 3
[0053] Example 3 Method of using the LAMP detection kit for ST-II type enterotoxigenic Escherichia coli
[0054] (a) DNA extraction: Extract DNA by boiling method, take 1mL of bacterial culture, centrifuge at 12000r / min for 5min; add 100μL of ultrapure water, mix well, boil at 100°C, quickly transfer to -20°C to freeze for 5min, then 4°C Centrifuge at 12000r / min for 5min. Take the supernatant, which is the DNA in the sample to be tested;
[0055] (b) LAMP amplification: Prepare 23 μL reaction solution , take 2μL of the sample DNA to be tested and the reaction solution Mix well to form a 25μL reaction system; take 1μL SYBR Green Add dropwise to the inside of the cap of the reaction tube, and operate carefully to prevent the dye from falling into the reaction system; place the reaction tube in a constant temperature water bath at 60°C to 63°C for 45 minutes for LAMP amplification, and heat at 85°C for 5 minutes to inactivate the activity of the enzyme;
[0056] (c) Take o...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap