Chimeric norovirus P particle and preparation and application thereof
A particle and virus technology, applied in the fields of molecular biology and immunology, can solve problems such as purification, difficult vaccines, and control of the number of difficult-to-insert epitopes, and achieve high antibody titers, high immunogenicity, and a low number of inserted epitopes. control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0106] Construction of embodiment 1.pET26b-P protein plasmid
[0107] Take 4 μg of pET26 vector plasmid (purchased from Novagen), add 1 μl each of Nde I enzyme and Xho I enzyme (purchased from Takara), and add 5 μl of enzyme digestion buffer (purchased from Takara), and finally add sterile Make the final volume to 50 μl with water, digest at 37°C for 5 hours, and perform agarose gel electrophoresis on the product, and recover it using a recovery column (purchased from Invetrogen) to obtain a plasmid vector with double-digested cohesive ends.
[0108] Through the method of gene synthesis, synthesize the P protein nucleotide sequence shown in SEQ ID NO: 9, use the above-mentioned same double enzyme digestion method, carry out Nde I / Xho I double enzyme digestion to the synthetic gene fragment, and the product Carry out agarose gel electrophoresis, use the recovery column to recover, and obtain the target gene fragment with double-digested cohesive ends.
[0109] Take the vector ...
Embodiment 2
[0110] Example 2. The construction site-directed mutagenesis method of pET26b-P protein plasmid with restriction sites mKpnI and mEagI is as follows:
[0111] 1. By site-directed mutagenesis, using the pET26b-P protein plasmid constructed in Example 1, mutating 5'CCGCCG3' into 5'CGGCCG3' to obtain the pET26b-Pprotein-mEagI plasmid containing the mEagI restriction site, and The amino acid sequence is not altered. The specific implementation method is as follows: Utilize a pair of completely complementary bidirectional primers comprising mutation sites:
[0112] SEQ ID NO: 11 (forward): 5'CGTTCACTTGGCTCCGGCCGTGGCTCCAACC3';
[0113] SEQ ID NO: 12 (reverse): 5'GGTTGGAGCCACGGCCGGAGCCAAGTGAACG3',
[0114] Carry out PCR reaction to the whole plasmid, and its PCR reaction system is KOD-Plus DNA polymerase system (purchased from TOYOBO company), and the total volume of reaction system is 50 μ l (buffer solution 5 μ l, dNTP 0.2mM, magnesium sulfate 1mM, each 0.3 of upstream and downst...
Embodiment 3
[0118] Example 3. Synthesis of P particle ring structure target gene fragment of chimeric human Aβ1-m gene
[0119] There are 3 different synthetic schemes for this step:
[0120] The first one is the target gene fragment of the P protein loop structure chimerized between the mKpnI restriction site and the SalI restriction site, that is, chimeric N only on loop1 1 A copy of the Aβ1-m gene, the P protein prepared by this method is referred to as P protein-N 1 copy-Aβ1-m-loop 1;
[0121] The second is the target gene fragment of the P protein loop structure chimerized between the SalI restriction site and the mEagI restriction site of the human Aβ1-m gene, that is, (1) chimeric N on loop2 only 2 A copy of the Aβ1-m gene, the P protein prepared by this method is referred to as P protein-N 2 copy-Aβ1-m-loop2; (2) Chimera N only on loop3 3 A copy of the Aβ1-m gene, the P protein prepared by this method is referred to as P protein-N 3 copy-Aβ1-m-loop3; (3) Chimeric N on loop2 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More