Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving resistance to bacterial blight of rice by using sucrose synthase

A technology for rice bacterial blight and sucrose synthase, which is applied in the field of constructing transsucrose synthase gene rice, and can solve problems such as bacterial blight resistance of plants without sucrose synthase.

Inactive Publication Date: 2017-08-18
HUAZHONG AGRI UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no report of sucrose synthase on improving plant bacterial blight resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving resistance to bacterial blight of rice by using sucrose synthase
  • Method for improving resistance to bacterial blight of rice by using sucrose synthase
  • Method for improving resistance to bacterial blight of rice by using sucrose synthase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] One, embodiment 1: the cloning of AtCESA8 promoter and OsSUS3 gene cDNA

[0035] The full-length AtCESA8 promoter was cloned from Arabidopsis thaliana with a length of 949bp. The cDNA of OsSUS3 gene was cloned from rice, the length was 2643bp, and the CDS was 2451bp. The PCR product was recovered, digested, and connected to the vector.

[0036] ——Using the genomic DNA of Arabidopsis thaliana as a template, primers were synthesized to amplify the AtCESA8 promoter.

[0037] F1: CCCAAGCTTCAGAGGAAACTCAGATGTGATGA;

[0038] R1: ACGCGTCGACCTTCGAATTCCCCTGTTTGGAGA;

[0039] ——Synthetic primers to amplify OsSUS3 cDNA

[0040] F2: ACGCGTCGACTTTCCTCCTCTTCTCCTTT;

[0041] R2: ACTGGCCCTGAAATCAAC

Embodiment 2

[0042] Two, embodiment 2: the construction of expression vector

[0043] 1. The construction of the OsSUS3 vector (pC1300T-AtCESA8-OsSUS3) overexpressing rice with the Arabidopsis AtCESA8 promoter (see image 3 ):

[0044] ——The promoter and the OsSUS3 cDNA sequence were respectively connected to the T vector, digested with restriction enzymes, and transferred into the expression vector pC1300T.

Embodiment 3

[0045] Three, embodiment 3: plant expression vector transforms Agrobacterium

[0046] 1. Agrobacterium activation

[0047] Draw the preserved Agrobacterium (EHA105) on the solid LB medium (add antibiotics: Kan, if no antibiotics are added, the Ti plasmid of these strains may be lost, resulting in the lack of infectivity of Agrobacterium), the antibiotic concentration is: 50μg / mL, culture at 28°C for 1-2 days, then transfer to a new solid LB medium with antibiotics and culture for another 2 days;

[0048] 2. Preparation of Agrobacterium Competent Cells

[0049] Inoculate 100 μL into 1 mL of LB liquid medium, shake at 150 rpm at 28°C overnight;

[0050] Take 1mL of the bacterial liquid and inoculate it into 100mL of liquid medium and cultivate until OD600=0.5;

[0051] Place the bacterial solution on ice for 30 minutes, and cool the culture to 0°C;

[0052] Centrifuge at 5000rpm for 30s at 4°C and discard the supernatant;

[0053] Precipitate with 60mL 0.1M CaCl 2 Suspende...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the resistance to bacterial blight of rice by using sucrose synthase, and relates to the technical field of molecular biology of transforming sucrose synthase rice. The method comprises the steps of (1) cloning an OsSUS3 gene cDNA from rice; (2) building an over-expression vector of the OsSUS3 gene, transforming rice Zhonghua (Chinese character) II and obtaining a transgenic plant, wherein rice seeds Sus3 (oryza sativa Sus3) of transforming OsSUS3 gene are preserved at the China Center for Type Culture Collection on January 3, 2017; and the preservation number is CCTCC NO:P201702; and (3) measuring the resistance to bacterial blight of the rice material of the obtained over-expressed OsSUS3 gene. The expression quantity of the OsSUS3 gene in the rice is increased, and the lengths of transgenic rice bacterial blight spots are reduced by 47% on the 15th day and reduced by 32% on the 20th day after inoculation in comparison with those in a control group.

Description

technical field [0001] The invention relates to a method for constructing sucrose synthase gene-transformed rice, which belongs to the molecular biology technology method of sucrose synthase-transformed rice, and specifically relates to a method for improving rice bacterial blight resistance by using sucrose synthase (OsSUS3). Background technique [0002] Sucrose synthase (EC 2.4.1.13, SUS) is a glycosyltransferase that catalyzes a reversible reaction: It is generally believed that it mainly plays a role in the decomposition of sucrose in plants [1,2] (Tsai et al., 1970; Su and Preiss, 1978). The sucrose synthase gene family of the monocotyledonous model species rice has 6 homologous genes named OsSUS1-6 respectively. When plants are under stress, sucrose (the main carbon source in plants) accumulates, which is a feedback regulation for plants to adapt to the external environment. Existing studies have shown that sucrose synthase can participate in the stress resistance ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/82A01H5/00
CPCC12N9/1051C12N15/8281C12Y204/01013
Inventor 彭良才范春芬丰胜求夏涛谢国生
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com