Application of MicroRNA31 Precursor Encoded Polypeptide in the Preparation of Immunomodulatory Drugs
A technology of immunomodulatory drugs and drugs, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0088] Example 1, miPEP31 sequence analysis and in vitro synthesis
[0089] 1. miPEP31 sequence analysis
[0090] The sequence of the miR-31 precursor is as follows:
[0091] ACGTAACCTAAAGCTAACAGACGGGGAAGCCATCACCAGGGTTTGGGTTGGATTCCCTACCAGTAAAATGAGGTAATGATGTGAAATTGGTCACGTTGTTGAAGAGTTGAA CTGTTGAACTGAGAACCTGCTATGCCAACATATTGCCATCTTTCCTGTCTGACAGCAGCTTGGCTACCTCCGTCCTGTTCCTCCTTGTCTTGCTACAAGCCATCCATGATATGTAGGGCCCTGTGACTTGGTCTGTCTCGCCCTGACTTCTCTCCAGTCCTATACCGAATCACTCGCTCTGTTCTAGCCACACTGGCCTTTTGGGGATGTTCTTGGCTGCACCAGGAATATTCCCGCCTCTACTGCCCTGTCTTATCTTTTGGGCATCAGTGGAGAACTCTTTCACCATGGCACTGTCTATAAAACCTTACATGTGCCCAGCCACCGTTCACCTCATGACCCTGCTCTGACTTGTCAGAATCATTGGGCACTACCTGTCCATGTTCATTTGCTTAGTTGCTGCTTGATTTACTGTACCAGGTTGTAAGTCCTTTAAGGGACACCCGTCTTCATTTCTGTTCACCATACCCCTAAACCCTGACGTTTGCAAGTCCTCAAGTCATGTCTTTGCGACTCTACCCTGGACTTATTGTGCAACAGAAGTGTCAAATAATGAGATTTTAATCATGCCATGAATGGCTGTGATGAAACACTGGTTTATAAGTAACAAAGAATAAACAAATGCTACTGATTTCTAAGCCTGCAAACCCAACATCTTAAAGGAGCCACAATAAAGTTACCATCAGGTCTACAACTCAG...
Embodiment 2
[0095] Example 2, expression of miPEP31 in cells
[0096] The coding sequence of miPEP31 was constructed into the Sal1 / Xhol1 restriction site of plasmid pEGFP-N1 (Addgene). Thus, the obtained heavy plasmid can form a fusion protein of miPEP31 and GFP after expression.
[0097] The recombinant plasmid obtained above was transfected into adipocyte precursor cells (3T3), and adipocyte somatic cells transformed with empty plasmid (pEGFP-N1blank) were used as a control. The blank group was only transfected with a blank GFP plasmid, and the miPEP31 group was transfected with both miPEP-GFP and GFP empty plasmids.
[0098] Cells were cultured, and after protein extraction, the expression of GFP was detected by electrophoresis-immunoblotting. The results were as follows: figure 1 .
[0099] The expression of GFP could be detected in the empty plasmid group, and two GFP bands were detected in the miPEP31 group, and one of them had a larger molecular weight, which was miPEP31 fused w...
Embodiment 3
[0103] Example 3, exogenously synthesized miPEP31 can enter cells
[0104] The miPEP31 miPEP obtained by the solid-phase peptide synthesis method in Example 1 is labeled with FITC at its C-terminus.
[0105] 1. 3T3 cells
[0106] 1nM FITC-labeled miPEP31 was co-cultured with 3T3 cells, and the FITC fluorescence of the cells was detected by flow cytometry. The result is as image 3 A, FITC signal can be observed in the cells, indicating that miPEP can enter 3T3 cells.
[0107] After the 3T3 cells were fixed, the nuclei were stained with DAPI, and then the fluorescence was observed with a confocal laser microscope. The result is as image 3 c. The nuclei were stained with DAPI, and blue fluorescence could be observed.
[0108] 3T3 cells were co-cultured with 1nM FITC-labeled miPEP31; after that, the cells were fixed, the nuclei were stained with DAPI, and the fluorescence was observed with a confocal laser microscope. The result is as image 3 From D to E, green fluoresc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More