Programmable multi-site specificity transcription inhibition system and application thereof

A site-specific and specific technology, applied in genetic engineering, using vectors to introduce foreign genetic material, biochemical equipment and methods, etc., can solve problems such as sgRNA expression

Inactive Publication Date: 2017-11-03
UNIV OF SCI & TECH OF CHINA +1
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are certain problems in this system, such as the expression of sgRNA in multi-site regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Programmable multi-site specificity transcription inhibition system and application thereof
  • Programmable multi-site specificity transcription inhibition system and application thereof
  • Programmable multi-site specificity transcription inhibition system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the construction of transcription inhibition test system

[0046] In the present invention, in Escherichia coli DH5α (TransGen Biotech), different plasmids are selected to express FndCpf1, sgRNA and fluorescent reporter protein respectively. The lower the intensity, the stronger the transcriptional repression, so as to study the transcriptional repression of FndCpf1 under different designs.

[0047] Among them, the FndCpf1 expression plasmid (full sequence is shown in sequence 3 in the sequence table), the promoter is a pTac inducible promoter, and isopropyl-β-D-thiogalactoside (IPTG) is used as an inducer to induce expression, Ampicillin resistance, p15A replicon. sgRNA expression plasmid, the promoter is J23119 constitutive promoter, chloramphenicol resistance, ColE1 replicon. The reporter plasmid (full sequence shown in sequence 5 in the sequence listing) uses sfgfp as the reporter gene, the promoter is the constitutive promoter of J23100, kanamycin r...

Embodiment 2

[0053] Example 2, Comparison of the transcriptional inhibition effects of different DNase mutants of FnCpf1

[0054] According to the genetic mutation studies of FnCpf1, the mutation of a single amino acid site in FnCpf1 (D917A) and FnCpf1 (E1006A) can make FnCpf1 lose its DNA-cleaving activity completely. Therefore, the present invention designs three FnCpf1 mutant forms, respectively FnCpf1 (D917A), FnCpf1 (E1006A), FnCpf1 (D917A, E1006A), the target site selects the non-template strand of the promoter region of the reporter gene, that is, NT strand, sgRNA Named as NTP1, the expression plasmids and sgRNA NTP1 expression plasmids of the three FndCpf1 mutants (constructed according to the method of Example 1, wherein the NTP1 primer containing the target sequence is F: agatgcactgtacctaggactgagctag; R: cttcctagctcagtcctagtacagtgc) and reporter plasmid (ie, Example The reporter plasmid in 1) was co-transfected into Escherichia coli DH5α, and the concentration of the inducer IPTG...

Embodiment 3

[0063] Example 3, Influence of repeat sequence length and spacer sequence length on transcription inhibition in the construction of sgRNA

[0064] 1. Changes in the length of the sgRNA target sequence

[0065] The inventors of the present invention selected a site on the coding region of the sfgfp gene in the reporter plasmid (ie, the reporter plasmid in Example 1), changed the length of the target sequence in the sgRNA, and explored its shortest target sequence length. In this experiment, the sequence length Set to 14-25nt (base-by-base increase) and 27nt, 29nt, 31nt ( image 3 Middle A).

[0066] The specific operation is as follows: the construction method of each sgRNA-related plasmid is shown in Example 1 ( figure 1 Middle D), the sequence information is shown in Table 3.

[0067] Table 3 Target sequence information of different lengths in sgRNA

[0068]

[0069] The expression plasmid of the FndCpf1 mutant was co-transfected with each sgRNA-related plasmid and rep...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a programmable multi-site specificity transcription inhibition system and the application thereof. The programmable transcription inhibition system with the multi-site specificity comprises (A) and (B) as follows: (A) site specificity transcription inhibition protein FndCpf1 (D917A), or DNA or RNA capable of expressing the FndCpf1 (D917A); (B) programmable sgRNA which consists of 19 to 36nt of repetitive sequences and variable 16 to 31nt of spacer sequences which are alternately arrayed in sequence from the end 5' to the end 3' and targets multiple sites, or a DNA circular plasmid or a DNA linear fragment capable of transcribing the programmable sgRNA. According to the programmable multi-site specificity transcription inhibition system, a gene transcription regulation and control tool which is efficient, has site specificity and can target multiple sites at the same time is obtained.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a programmable multi-site specific transcription suppression system and its application. Background technique [0002] Programmable site-specific gene regulatory elements play an important role in genome-wide gene function research, metabolic pathway regulation, and artificial gene circuit design. At present, researchers have developed many programmable gene regulatory elements, including RNAi (RNA interference), engineered DNA-binding proteins (such as zinc-finger protein ZFP (zinc-finger protein), transcription-activator-like effector protein TALE (transcription- activator-likeeffector protein) and CRISPRi based on the CRISPR-Cas system. Among them, the RNAi-mediated gene knockdown technology has low specificity and is limited by the acting body, while the regulation technology based on DNA binding proteins, such as zinc finger protein ZFP and transcriptional activation TALE-like ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/113
CPCC12N15/70C12N15/113C12N2310/10C12N2800/80C12N2810/10C12N2830/00
Inventor苗晨思赵会伟关莹陈泽华娄春波
OwnerUNIV OF SCI & TECH OF CHINA