Primer probes, kits and methods for precise quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain

A quantitative detection and genetically modified technology, applied in biochemical equipment and methods, microbial measurement/inspection, DNA/RNA fragments, etc., can solve the problems of increased detection difficulty and large quantity, and achieve accurate and sensitive results and accurate quantitative results , the effect of high detection sensitivity

Active Publication Date: 2021-03-02
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the large number and variety of genetically modified foods, especially after many genetically modified foods are processed and stored under various conditions, the genetically modified ingredients are degraded in large quantities, making detection more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probes, kits and methods for precise quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain
  • Primer probes, kits and methods for precise quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain
  • Primer probes, kits and methods for precise quantitative detection of specific gene components of transgenic rice Kefeng No. 6 strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] For the first time, the inventors of the present invention amplified the specific genes of the transgenic rice Kefeng No. 6 line by real-time fluorescent PCR (probe method). The probe sequence of the specific gene primers used for transgenic rice Kefeng No. 6 line is the upstream primer KF6-LFCACGACCCGGCCAGTTAAG (SEQ ID No.1), and the downstream primer is KF6-LR CATTAAGAACGTCCGCAATGTGT (SEQ ID No.2); the probe is KF6- LP CCCGAATTAATTCGGGGGATCTGGA (SEQ ID No. 3).

[0026] 1. Main testing instruments used:

[0027] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.

[0028] 2. Main reagents for detection:

[0029] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.

[0030] 3. Main steps of detection:

[0031] Real-time fluorescent PCR reaction system:

[0032] 2×Mastermix 12.5μL

[0033] Upstream primer (10mM) 1.0μL

[0034] ...

Embodiment 2

[0046] In this example, the gene copy number of the transgenic rice was quantitatively detected by digital PCR by using the specific primer probe sequence of the transgenic rice Kefeng No. 6 line. The probe sequence of the transgenic rice Kefeng No. 6 line-specific primers used was KF6-LF CACGACCCGGCCAGTTAAG (SEQ ID No.1) for the upstream primer, and KF6-LRCATTAAGAACGTCCGCAATGTGT (SEQ ID No.2) for the downstream primer; the probe was KF6 -LP CCCGAATTAATTCGGGGGATCTGGA (SEQ ID No. 3) (SEQ ID No. 3).

[0047] 1. Main testing instruments used:

[0048] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12 000 r / min), etc.

[0049] 2. Main reagents for detection:

[0050] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.

[0051] 3. Main steps of detection:

[0052] Digital PCR reaction system:

[0053] 2×Mastermix 10 μL

[0054] Upstream primer (10mM) 1.0μL

[0055] Downstream primer (10mM) 1.0μL

[0056...

Embodiment 3

[0065] The method is the same as that described in Example 2, except that the genomic DNA of the transgenic rice sample is first diluted 5 times and then diluted 10 times in 3 gradients as a template. Each dilution gradient is repeated 3 times, and the transgenic rice Kefeng No. 6 is used. The sequence of the amplification primer probe is the same as that in Example 2, and quantitative detection by digital PCR is carried out to determine the sensitivity of the method.

[0066] As shown in Table 1, the contents of the genomic DNA stock solution of transgenic rice samples diluted 5 times, 25 times, and 250 times were 168 copies / μL, 34.5 copies / μL, and 3.65 copies / μL, respectively, and the deviations from the theoretical values ​​were - 2.44, 0.15, and 1.74, basically in line with the theoretical copy number, and the RSD values ​​of the three replicates of each dilution gradient were 3.61%, 4.28%, and 13.8% (Table 1), indicating that this accurate quantitative detection method det...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an oligonucleotide primer probe for precise quantitative detection of specific gene components of the transgenic rice Kefeng No. 6 strain, and a kit comprising the primer probe. The present invention also relates to a digital PCR detection method for quantitatively detecting the specific gene components of the transgenic rice Kefeng No. 6 strain, said method comprising using specific oligonucleotide primers and Fluorescently labeled probes. The invention also relates to the application of the specific oligonucleotide primers and fluorescent probes for the specific genes of the transgenic rice strains in the quantitative detection of the specific gene components of the transgenic rice Kefeng No. 6 strain. The digital PCR detection method of the present invention can accurately and sensitively measure the content of specific gene components of the transgenic rice Kefeng No. 6 strain in the sample, and the sensitivity can reach 1 copy / μL.

Description

technical field [0001] The invention belongs to the field of biotechnology. Specifically, the invention relates to oligonucleotide primers and fluorescent labeling probes for the detection of specific gene components of the transgenic rice Kefeng No. 6 strain, a kit containing the primer probes, The digital PCR detection method for the determination of the specific gene components of the transgenic rice Kefeng No. 6 strain and the specific oligonucleotide primers and probes for the specific gene components of the transgenic rice Kefeng No. Application of No. 6 strain-specific genetic components. Background technique [0002] With the extensive research on genetically modified products and their wide application in daily life, the safety issues brought by genetically modified products to human health and living environment have aroused widespread concern and controversy in the world. Therefore, while actively researching genetically modified technology, various countries in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6895C12Q2531/113C12Q2561/101
Inventor 陈颖黄文胜邓婷婷葛毅强周杰芦云
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap