LAMP primer composition for detecting two main parasites causing calf diarrhea and application of LAMP primer composition

A technology of primer combination and calf diarrhea, which is applied in the field of LAMP primer combination of two main parasites, can solve the problems of high primer specificity, high price, long detection cycle, etc., and achieve great promotion value, high sensitivity, highly specific effect

Active Publication Date: 2017-11-21
HENAN ACAD OF AGRI SCI +2
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The traditional gene identification methods are PCR method and DNA sequencing method. The traditional PCR method has a long detection cycle and usually takes 3-4 hours; Sanger DNA sequencing method requires high primer specificity and is expensive. Later data The analysis is complicated and not suitable for clinical promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer composition for detecting two main parasites causing calf diarrhea and application of LAMP primer composition
  • LAMP primer composition for detecting two main parasites causing calf diarrhea and application of LAMP primer composition
  • LAMP primer composition for detecting two main parasites causing calf diarrhea and application of LAMP primer composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1. Preparation of primer set I and primer set II

[0066] The kit consists of two LAMP primer sets, each of which is used to detect a parasite that causes calf diarrhea.

[0067] The primer set used to detect the parasite Eimeria ITS-2 gene is as follows (5’→3’):

[0068] Outer primer F3 (sequence 1): TTCTACATGTTTGATGCCTTC;

[0069] Outer primer B3 (sequence 2): CCAAACCAAACAATGCTCAA;

[0070] Inner primer FIP (sequence 3): GGAAAAGAAAGGATATGGGCTTGTACGCGGTGTGTCAGAAGT;

[0071] Inner primer BIP (sequence 4): GGTGGATGGATTCTAAGTATTCTCCACACAACACCACCACAGCT;

[0072] Loop primer LF (sequence 5): AGCCATTCATACAACAACAGCAAT;

[0073] Loop primer LB (sequence 6): ATCTCATATTTTAGGAGTTTGGCGA.

[0074] The primer set used to detect the SSU RNA gene of the parasite Cryptosporidium parvum is as follows (5’→3’):

[0075] Outer primer F3 (sequence 7): CGAAAGCATTTGCCAAGG;

[0076] Outer primer B3 (sequence 8): AGGCTCCACTCCTGGTG;

[0077] Inner primer FIP (sequence 9): CAACCTCCAATCTCTAGTTGGCGAACGAAAGT...

Embodiment 2

[0085] Example 2. Specificity of primer combination

[0086] 1. Preparation of the sample to be tested

[0087] Sample to be tested 1: Bovine Eimeria ITS-2 gene plasmid.

[0088] Sample to be tested 2: Cryptosporidium parvum SSU RNA gene plasmid.

[0089] The preparation method of each plasmid is as follows:

[0090] Eimeria bovis ITS-2 gene plasmid: Insert the DNA molecule shown in the nucleotide sequence of Genebank No. AB769731.1 between the MCS of plasmid pUC57 (Sangong Bioengineering (Shanghai) Co., Ltd.) to obtain recombination Plasmid, which is the Eimeria bovis ITS-2 gene plasmid.

[0091] Cryptosporidium parvum SSU RNA gene plasmid: Insert a DNA molecule with the nucleotide number of Genebank AF093490.1 between the MCS of plasmid pUC57 (Sanggong Bioengineering (Shanghai) Co., Ltd.) to obtain a recombinant plasmid, which is Resistance gene SSU RNA gene plasmid.

[0092] 2. Testing of samples to be tested

[0093] Each sample to be tested is tested by the following steps:

[0094] ...

Embodiment 3

[0101] Example 3. Sensitivity of primer combination

[0102] Sample to be tested 1: The Eimeria bovis ITS-2 gene plasmid of Example 2.

[0103] Sample to be tested 2: Cryptosporidium parvum SSU RNA gene plasmid of Example 2.

[0104] 1. Extract the plasmid DNA of the sample to be tested and dilute it stepwise with sterile water to obtain each dilution.

[0105] 2. Using the diluent obtained in step 1 as a template, the primer set I and primer set II prepared in Example 1 were used for loop-mediated isothermal amplification.

[0106] When the sample to be tested is the sample to be tested 1, use primer set I for loop-mediated isothermal amplification. When the test sample is the test sample 2, the primer set II is used for loop-mediated isothermal amplification.

[0107] Reaction system (10μL): 7.0μL reaction solution (product of Boao Biological Group Co., Ltd., its product catalog number is CP.440020), 1μL primer mixture, 1μL dilution solution (1μL dilution solution contains 10 genome c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and particularly discloses an LAMP primer composition for detecting two main parasites causing calf diarrhea and application of the LAMP primer composition. The LAMP primer composition for detecting the Eimeria bovis and / or Cryptosporidium parvum which cause the calf diarrhea is a primer group I and / or a primer group II. The primer group I comprises a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB, and the nucleotide sequences of the primers are as shown in SEQ ID No. 1-6. The primer group II comprises a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB, and the nucleotide sequences of the primers are as shown in SEQ ID No. 7-12. The LAMP primer composition is used for detecting two common parasites causing the calf diarrhea and is high in specificity and sensitivity, capable of achieving simple, fast and accurate detection and worthy of popularization.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular, to a LAMP primer combination for detecting two main parasites that cause calf diarrhea and its application. Background technique [0002] With the improvement of people’s living standards in our country, the consumption demand for beef and milk is growing, which has promoted the development of the cattle industry. However, the outbreak of infectious parasitic diseases is also on the rise, and it has seriously affected the growth and development of cattle. Bring huge economic losses to farmers. The parasites that cause serious consequences are mainly coccidia and cryptosporidium. [0003] Bovine coccidiosis can infect various breeds of cattle, especially calves under 2 years of age with the highest morbidity and mortality. Diarrhea is the main clinical feature of the disease, and the more coccidia in the affected cattle, the more The more severe the symptoms. The pathogen is Eimeria...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/6893C12Q2531/119Y02A50/30
Inventor张震郑艳茹闫磊闫跃飞李静茹赵新芳皇朝英薛勇康赵玉玺李加涛刘长磊
OwnerHENAN ACAD OF AGRI SCI