Biosafety Klebsiella variicola and application thereof in producing 1,3-propylene glycol
A Klebsiella, propylene glycol technology, applied in the field of microorganisms, can solve the problems of lack of enhanced expression of tqsA gene, tqsA gene function research and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] This embodiment provides a Klebsiella mutans F2R9 T The method for constructing derivative strains of, which includes the following steps:
[0057] Step 1, PCR amplification of Klebsiella mutans F2R9 T The upstream and downstream nucleotide segments of the tqsA gene promoter in the genomic sequence of are named segment A and segment B, respectively, where:
[0058] Fragment A is PCR amplified Klebsiella mutans F2R9 T The 500bp nucleotide fragment upstream of the tqsA gene promoter in the genome sequence of, the primers for amplification are:
[0059] A-F: CCGCAAGCTTGACAAGGTGCCGGTAATTTC (as shown in SEQ ID NO:1)
[0060] A-R: AGGTCCCGACCTCAATCTTC (as shown in SEQ ID NO: 2);
[0061] Fragment B is PCR amplified Klebsiella mutans F2R9 T The 500bp nucleotide fragment downstream of the tqsA gene promoter in the genome sequence of, the primers for amplification are:
[0062] B-F: ATGGCTAAACCCATTATTAC (as shown in SEQ ID NO: 3)
[0063] B-R: CACGCCCGGGTGGGGGACCTCCAGCAGCAT (as shown in SEQ...
Embodiment 2
[0085] This example provides Klebsiella mutans F2R9 T And the application of Klebsiella mutans TqsA constructed in Example 1 above in the production of 1,3-propanediol by fermenting glycerol.
[0086] In this embodiment, the method for producing 1,3-propanediol by small-scale shake flask fermentation using the above two strains includes the following steps:
[0087] (1) The above Klebsiella mutans F2R9 T Or Klebsiella mutans TqsA was inoculated into a 250mL shake flask containing 50mL LB liquid medium, and cultivated at 37°C and 220rpm for 12 hours to obtain seed liquid;
[0088] (2) Inoculate the above seed liquid in a 250 mL shake flask containing 50 mL of LB glycerol liquid medium at a ratio of 10%, and cultivate for 12 hours at 37°C and 220 rpm to obtain a fermentation broth;
[0089] (3) Use gas chromatography to detect the concentration of 1,3-propanediol in the fermentation broth, Klebsiella mutans F2R9 T Produced 1,3-propanediol with a concentration of 6.5g / L, the conversion ra...
Embodiment 3
[0092] This example provides Klebsiella mutans F2R9 T And the application of Klebsiella mutans TqsA constructed in Example 1 above in the production of 1,3-propanediol by fermenting glycerol.
[0093] In this embodiment, the method for producing 1,3-propanediol by fermenting the above two strains in a fermentor includes the following steps:
[0094] (1) The above Klebsiella mutans F2R9 T Or Klebsiella mutans TqsA was inoculated in a seed culture medium using glycerol as a carbon source, and cultured for 12 hours at a temperature of 35°C, a medium pH of 7.0, and a rotation speed of 200 rpm to obtain a seed culture solution . Wherein, 1L of the seed medium with glycerol as a carbon source contains: glycerol 20g, K 2 HPO 4 ·3H 2 O3.20g, KH 2 PO 4 1.20g, NH 4 Cl 2.85g, yeast extract 2.00g.
[0095] (2) Inoculate the above-mentioned seed liquid in a fermentation tank containing a fermentation medium with glycerol as a carbon source, under the conditions of a temperature of 35°C, a mediu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

