Unlock instant, AI-driven research and patent intelligence for your innovation.

Biosafety Klebsiella variicola and application thereof in producing 1,3-propylene glycol

A Klebsiella, propylene glycol technology, applied in the field of microorganisms, can solve the problems of lack of enhanced expression of tqsA gene, tqsA gene function research and other problems

Active Publication Date: 2017-11-24
ZHANGJIAGANG GLORY CHEM IND CO LTD
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Klebsiella mutabilis F2R9 T The results of the genome annotation of the strain showed that the strain has the tqsA gene, but there is no relevant functional research on the Klebsiella tqsA gene, and there is no report on the enhanced expression of the tqsA gene to enhance the fermentation of microorganisms to produce 1,3-propanediol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosafety Klebsiella variicola and application thereof in producing 1,3-propylene glycol
  • Biosafety Klebsiella variicola and application thereof in producing 1,3-propylene glycol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] This embodiment provides a Klebsiella mutans F2R9 T The method for constructing derivative strains of, which includes the following steps:

[0057] Step 1, PCR amplification of Klebsiella mutans F2R9 T The upstream and downstream nucleotide segments of the tqsA gene promoter in the genomic sequence of are named segment A and segment B, respectively, where:

[0058] Fragment A is PCR amplified Klebsiella mutans F2R9 T The 500bp nucleotide fragment upstream of the tqsA gene promoter in the genome sequence of, the primers for amplification are:

[0059] A-F: CCGCAAGCTTGACAAGGTGCCGGTAATTTC (as shown in SEQ ID NO:1)

[0060] A-R: AGGTCCCGACCTCAATCTTC (as shown in SEQ ID NO: 2);

[0061] Fragment B is PCR amplified Klebsiella mutans F2R9 T The 500bp nucleotide fragment downstream of the tqsA gene promoter in the genome sequence of, the primers for amplification are:

[0062] B-F: ATGGCTAAACCCATTATTAC (as shown in SEQ ID NO: 3)

[0063] B-R: CACGCCCGGGTGGGGGACCTCCAGCAGCAT (as shown in SEQ...

Embodiment 2

[0085] This example provides Klebsiella mutans F2R9 T And the application of Klebsiella mutans TqsA constructed in Example 1 above in the production of 1,3-propanediol by fermenting glycerol.

[0086] In this embodiment, the method for producing 1,3-propanediol by small-scale shake flask fermentation using the above two strains includes the following steps:

[0087] (1) The above Klebsiella mutans F2R9 T Or Klebsiella mutans TqsA was inoculated into a 250mL shake flask containing 50mL LB liquid medium, and cultivated at 37°C and 220rpm for 12 hours to obtain seed liquid;

[0088] (2) Inoculate the above seed liquid in a 250 mL shake flask containing 50 mL of LB glycerol liquid medium at a ratio of 10%, and cultivate for 12 hours at 37°C and 220 rpm to obtain a fermentation broth;

[0089] (3) Use gas chromatography to detect the concentration of 1,3-propanediol in the fermentation broth, Klebsiella mutans F2R9 T Produced 1,3-propanediol with a concentration of 6.5g / L, the conversion ra...

Embodiment 3

[0092] This example provides Klebsiella mutans F2R9 T And the application of Klebsiella mutans TqsA constructed in Example 1 above in the production of 1,3-propanediol by fermenting glycerol.

[0093] In this embodiment, the method for producing 1,3-propanediol by fermenting the above two strains in a fermentor includes the following steps:

[0094] (1) The above Klebsiella mutans F2R9 T Or Klebsiella mutans TqsA was inoculated in a seed culture medium using glycerol as a carbon source, and cultured for 12 hours at a temperature of 35°C, a medium pH of 7.0, and a rotation speed of 200 rpm to obtain a seed culture solution . Wherein, 1L of the seed medium with glycerol as a carbon source contains: glycerol 20g, K 2 HPO 4 ·3H 2 O3.20g, KH 2 PO 4 1.20g, NH 4 Cl 2.85g, yeast extract 2.00g.

[0095] (2) Inoculate the above-mentioned seed liquid in a fermentation tank containing a fermentation medium with glycerol as a carbon source, under the conditions of a temperature of 35°C, a mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides biosafety Klebsiella variicola and application thereof in producing 1,3-propylene glycol. Klebsiella varricola TqsA enhancing tqsA genetic expression is built by virtue of a gene engineering method, and a method for producing 1,3-propylene glycol by adopting Klebsiella varricola F2R9T and the Klebsiella varricola TqsA to ferment glycerinum by optimizing a fermentation process is provided. The method for producing the 1,3-propylene glycol by adopting Klebsiella F2R9T to ferment the glycerinum is firstly provided, the Klebsiella varricola TqsA enhancing the tqsA genetic expression is built by virtue of a genetic engineering means, so as to enhance the production of the 1,3-propylene glycol; and by adopting the optimized fermentation process, the yield of the 1,3-propylene glycol produced by the Klebsiella F2R9T can reach 72 g / L, and the yield of the 1,3-propylene glycol produced by adopting the Klebsiella varricola TqsA to ferment the glycerinum reaches 85 g / L, so that a biosafety strain and a process for efficiently producing the 1,3-propylene glycol are provided for the microbial fermentation and production of the 1,3-propylene glycol.

Description

Technical field [0001] The invention belongs to the technical field of microorganisms, and relates to a biologically safe Klebsiella mutans and its application in the production of 1,3-propanediol. Background technique [0002] 1,3-Propanediol has a wide range of uses. It is a very important chemical product and platform compound. It can be used as an adhesive, protective agent, lubricant, antifreeze and solvent in the fields of polymer materials, medicine, chemicals, food and cosmetics. Both have a wide range of applications. Its most important use is the production of polytrimethylene terephthalate (PTT). The good characteristics of PTT, including washing property, ductility and resilience have made its market demand increasingly expanded. This has stimulated the market demand for 1,3-propanediol (Liu H. et al., Biotechnol J. 2010, 5(11): 1137–1148). [0003] In view of the important role of 1,3-propanediol and the various disadvantages of chemical synthesis, research on the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P7/18C12N1/21C12R1/22
Inventor 韩冰
Owner ZHANGJIAGANG GLORY CHEM IND CO LTD