Unlock instant, AI-driven research and patent intelligence for your innovation.

brocoli botlp1 The coding sequence of the gene and its application in breeding salt-tolerant and drought-resistant transgenic plants

A technology for transgenic plants and coding sequences, which is applied in the field of modern molecular biology transgenic plants, can solve the problems of restricted and popularized planting, weak cold resistance and salt tolerance of cauliflower, and achieves the effects of low cost, high broad-spectrum and high transformation efficiency.

Active Publication Date: 2021-06-25
NANKAI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] brocoli( Brassica oleracea L .var. botrytis ) is an important vegetable crop. my country is the country with the largest cauliflower planting area in the world, but the cold and salt tolerance of cauliflower is relatively weak, which limits its popularization and planting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • brocoli <i>botlp1</i> The coding sequence of the gene and its application in breeding salt-tolerant and drought-resistant transgenic plants
  • brocoli <i>botlp1</i> The coding sequence of the gene and its application in breeding salt-tolerant and drought-resistant transgenic plants
  • brocoli <i>botlp1</i> The coding sequence of the gene and its application in breeding salt-tolerant and drought-resistant transgenic plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A Cauliflower Salt and Drought Tolerance Gene BoTLP1 的编码序列,它由序列5’ ATGATTTATCAAAAAACACTTCTCACAGTCTTTTTCTTTGCATTTATCACCATATACTTTGTAATCTTAGCAGATGCGACTACGTTCACAGTAAGGAACAATTGTCCATATGTTGTGTGGGCTGCCACATCTGCTCCGGGAAAGCCTGGCGGTGGGAAGCGACTCAATCAAGGCGAAACGTGGATCGTTACTGGTGATCCAGGTACCACCCAGGCTCGGATTTGGGGTCGTACCAACTGCAACTTCGATGTCTCTGGAAGAGGTGGATGCCAAACTGGAGATTGTAATGGTGTACTTGAGTGCAAATCTTATGGACGAGCACCAAATACATTGGCAGAATATTCTCTTAAACAATATGCAGACCAAGATTTCATCGATATTTCTGTGATCGATGGATTCAATATTCCAATGGAATTCAGTTCTGCATCTGGACAATGCACCCGCAAAATTAGGTGTACGGGAGATATTATAGCTCAATGTCCAGCCCAACTAAGAATGGACGGCGCTTGCAACGGACCGTGTCCGGTGTTGAAGACGGAGGAACATTGTTGCAACTCTGGTAATTGTGGACCGACCCCACTCTCTATGTTTTTCAAGCAACGTTGTCCAGATGCCTATAGTTATCCTAAGGATGATCCCACCAGCCCTTTCACTTGCCCTAGCGGAACCAACTACAATGTCATTTTCTGTCCGTGA3’组成(SEQ ID NO:1)。

[0035] The method for cultivating salt-tolerant and drought-resistant transgenic plants using the above-mentioned gene coding sequence comprises the following steps:

[0036] (1) Extraction of total RNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cauliflower BoTLP1 The coding sequence of the gene, and the method for cultivating salt-tolerant and drought-resistant transgenic plants by using the above-mentioned gene coding sequence include the following steps: (1) total RNA extraction and cDNA synthesis of cauliflower; (2) design and synthesis of primers with enzyme cleavage sites; 3) Construction of overexpression transformation vector; (4) Genetic transformation; (5) Screening of transgenic positive seedlings; (6) Observation of stress-resistant biological traits of transgenic plants. The observation results showed that the transgenic plants had obvious characteristics of drought resistance and salt tolerance compared with the wild type, and could survive for more than 10 days longer than the wild type under continuous drought conditions; they could grow normally under 200 mmol / L salt treatment. The method for cultivating salt-resistant and drought-resistant transgenic plants by using gene coding sequences disclosed by the invention is of great value for revealing the molecular basis of salt-resistant and drought-resistant cauliflower and for cultivating highly salt-resistant and drought-resistant crops or economic plants by means of genetic engineering.

Description

technical field [0001] The invention belongs to the technical field of modern molecular biological transgenic plants, and relates to a broccoli salt-tolerant and drought-resistant gene in biotechnology BoTLP1 The coding sequence of and its application in breeding salt-tolerant and drought-resistant transgenic plants. Background technique [0002] Soil salinization and drought are the main factors causing crop yield reduction or even extinction. my country is the country with the largest arid and semi-arid area in the world. At the same time, my country also has a large area of ​​saline-alkaline land. The area of ​​saline-alkali land accounts for about 20% of the country's cultivated land. Moreover, due to seawater intrusion and other factors, the area of ​​saline-alkali land has further expanded, seriously encroaching on my country's limited cultivated land area. Therefore, in order to ensure my country's food security, cultivating new varieties of salt-tolerant and drough...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/66A01H5/00A01H6/20
CPCC07K14/43C12N15/66C12N15/8273
Inventor 王春国李慧陈成彬宋文芹
Owner NANKAI UNIV