Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, kit and method for detecting pseudomonas aeruginosa and clostridium perfringens

A technology of Pseudomonas aeruginosa and Clostridium perfringens, applied in biochemical equipment and methods, microorganism-based methods, microorganisms, etc., can solve the problem of detection of Pseudomonas aeruginosa and Clostridium perfringens See reports and other issues to achieve good industrialization prospects, reasonable components and ratios, and shorten the detection cycle

Inactive Publication Date: 2017-12-26
INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY EXIT INSPECTION AND QUARANTINE
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] However, there are few reports on the analysis of copy number based on the droplet digital PCR platform, let alone the detection of Pseudomonas aeruginosa and Clostridium perfringens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The present invention detects the primers of Pseudomonas aeruginosa and Clostridium perfringens in water, and the sequences of the primers are respectively:

[0044] It is characterized in that the 20.0 μL reaction system in the kit includes the following components: 10.0 μL of 2×ddPCR Super Mix, 0.1-1.0 μL of forward and reverse primers for Pseudomonas aeruginosa and Clostridium perfringens, and 0.1-1.0 μL for each probe 0.1-1.0 μL, DNA template 4.0 μL.

Embodiment 2

[0046] The present invention is a kit for detecting Pseudomonas aeruginosa and Clostridium perfringens in water, wherein the 20 μL reaction system comprises the following components:

[0047] Among them, 10.0 μL of 2×ddPCR Super Mix, 1.0 μL of forward and reverse primers for Pseudomonas aeruginosa and Clostridium perfringens, 1.0 μL of each probe, and 4.0 μL of DNA template.

[0048] Wherein the primer sequences are as follows:

[0049] Upstream primer P.AF: TGGTAGTCCACGCCGTAAA

[0050] Downstream primer P.AR:CAGACTGCGATCCGGACTACG

[0051] Probe P.AP: TCGACCGCCTGGGGAGTACG

[0052] Upstream primer C.PF: TTGATAGCGCAGGACATGTT

[0053] Downstream primer C.PR: CATGTAGTCCACTGTTCCAGCA

[0054] Probe C.PP: ACAGCAGGTTGCAAAACTAATGAGGC.

Embodiment 3

[0056] The present invention detects the method for Pseudomonas aeruginosa and Clostridium perfringens in water, comprises the following steps:

[0057] A. Extract sample DNA;

[0058] B. Add each reaction component to the above 20.0 μl reaction system, then add 70.0 μl mineral oil, mix well and transfer to the droplet generator to automatically generate droplets;

[0059] C. Carefully transfer all the generated micro-droplets to the PCR reaction tube of the 96-well reaction plate; then seal the 96-well reaction plate on a film sealing machine, and place it in an ordinary PCR machine for PCR reaction.

[0060] D. Open the application software of the droplet fluorescence detector, insert the 96-well reaction plate after the PCR reaction directly into the device, detect the PCR reaction of the droplet in each PCR reaction tube, and finally calculate the copy of the gene to be tested according to the Poisson distribution law number.

[0061] Wherein the primer sequences are as ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a kit and a method for detecting Pseudomonas aeruginosa and Clostridium perfringens. The primer sequence and probe sequence are respectively: upstream primer P.AF, downstream primer P.AR, probe P .AP, upstream primer C.PF, downstream primer C.PR:, probe C.PP. The purpose of the present invention is to overcome the deficiencies in the prior art, to provide a primer with reasonable components and ratio, easy to use, fast and accurate detection, suitable for double ddPCR detection of Pseudomonas aeruginosa and gas production in water The test kit of Clostridium perfringens; Another purpose of the present invention is to provide a kind of method that adopts above-mentioned test kit to detect Pseudomonas aeruginosa and Clostridium perfringens in water, and this method is easy and simple to operate, fast, and cost is low, and detection result precise.

Description

technical field [0001] The invention relates to a primer for detecting Pseudomonas aeruginosa and Clostridium perfringens, and also relates to a double droplet digital PCR detection reagent for detecting Pseudomonas aeruginosa and Clostridium perfringens in water The present invention also relates to a method for detecting Pseudomonas aeruginosa and Clostridium perfringens in drinking water by using the kit. Background technique [0002] Pseudomonas aeruginosa Pseudomonas aeruginosa formerly known as Pseudomonas aeruginosa. It is widely distributed in nature and is one of the most common bacteria in soil. All kinds of water, air, skin, respiratory tract and intestinal tract of normal people have this bacteria. The important condition for the existence of this bacterium is a humid environment. The bacterium is a common environmental microorganism. Because it has low nutritional requirements and is good at using various carbon sources and ammoniated compounds as nitrogen so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/385C12R1/145
CPCC12Q1/689C12Q1/6851C12Q2600/16
Inventor 蔡先全张宪臣邱德义丁宁周晓彤
Owner INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY EXIT INSPECTION AND QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More