Killing cell for high-efficiency and stable expression of antibodies and use thereof

A cell-killing and lethal technology, applied in the fields of cell biology and oncology, can solve problems such as insufficiency, unsustainable expression, loss, etc.

Pending Publication Date: 2017-12-29
SHANGHAI CELL THERAPY RES INST +1
View PDF7 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although there have been reports of transfection of exogenous genes into, for example, NK cells or T cells, the commonly used gene transfection vector systems have a low transfection rate for effector immune cells with cell killing toxicity, or it is difficult to make exogenous genes in their cells express at a high level
The use of adenoviral vectors (non-integrated) can mediate the efficient short-term expression of foreign genes in NK cells or T cells, but the proliferation of activated NK cells or T cells is very fast, and the expression cassettes of foreign genes carried are in It will be lost rapidly during cell passage, and the expression is difficult to last; the integration of foreign genes in the genome of NK cells or T cells can be mediated by retrovirus or lentivirus, and stable expression can be achieved in theory, but the antibody contains light chain and heavy chain , the coding sequence is long and the molecular weight is large, which leads to great difficulties in the packaging and preparation of retroviruses or lentiviruses carrying full-length antibody expression cassettes, and it is difficult to express antibodies efficiently. It can only be used to express single-chain antibodies with simple structures (lack of Fc segment fragment, incomplete function and short half-life)
Therefore, before this, there are no reports of transgenic cells that have cytotoxicity and can stably express antibodies containing human Fc fragments at high levels

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Killing cell for high-efficiency and stable expression of antibodies and use thereof
  • Killing cell for high-efficiency and stable expression of antibodies and use thereof
  • Killing cell for high-efficiency and stable expression of antibodies and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0137] Example 1: Construction of recombinant plasmids pS838-AntiPD1 and pNB328-CD20BR

[0138] Entrusted Shanghai Jereh Biological Company to synthesize two DNA sequences, the sequences are as follows:

[0139] Seq1: CGATAGGACGCTGATCTTAAT (SEQ ID NO: 1)

[0140] Seq2: TACCTGCGACTAGAAT (SEQ ID NO:2)

[0141] Denaturation at 98°C for 5 minutes, followed by natural cooling to form double-stranded DNA adapters with ClaI and PacI sticky ends at the upstream and downstream respectively.

[0142] The pNB vector was double-digested with CalI and PacI (refer to CN201510638974.7 for the construction process), and loaded with the above double-stranded DNA to obtain the pS vector.

[0143] According to the CCEF promoter sequence published by CN201510021408.1, Shanghai Jereh Biological Co., Ltd. was commissioned to synthesize it, and introduced XbaI and EcoRI restriction sites in the upstream and downstream, respectively, and loaded it into the pS vector that was double-digested with ...

Embodiment 2

[0151] Example 2: Genetic modification of peripheral blood T lymphocytes

[0152] Prepare 1×10 7 Freshly isolated peripheral blood mononuclear cells (PBMC) were co-transfected with pNB328-CD20BR and pS838-antiPD1 into the nuclei with a Lonza 2b-Nucleofector instrument at a ratio of 1:2, and placed at 37°C for 5 %CO 2 Culture in an incubator; transfer to a 6-well plate containing 30ng / mL anti-CD3 antibody and 3000IU / mL IL-2 (purchased from Novoprotein Company) after 6 hours, and place at 37°C, 5% CO 2 Incubator culture. After the cells grow healthily, the pluripotent T cells expressing PD1 antibody, referred to as PIK-T, are obtained. Untransfected PBMC were spread on a culture plate containing 30ng / mL anti-CD3 antibody and 3000IU / mL IL-2 (purchased from Novoprotein Company) at 37°C and 5% CO 2 cultured in an incubator as a control. Since only the pNB328 vector contains the transposase required for exogenous gene integration, and the pS838 vector only contains the ITR el...

Embodiment 3

[0153] Example 3: Quantitative detection of PD1 antibody expression in PIK-T cells

[0154] The PIK-T and control T cells prepared in Example 2 were subcultured at a dilution ratio of 1:3, and two weeks later, 1.0×10 6 Cells / well were spread in a 6-well plate with 4ml of AIM-V medium (purchased from Gibco), placed at 37°C, 5% CO 2 Culture in an incubator, and collect 800 μl of cell supernatant after 24 hours, 48 ​​hours, 72 hours, and 96 hours of culture, and store at -20°C for future use. Human PD1 recombinant protein was used to coat the microtiter plate (purchased from SinoBiological Company), and HRP-labeled mouse anti-human IgG mAb (purchased from Abcam Company) was used for detection, and commercialized anti-PD1 antibody (purchased from Merck Company) was used as For standard products, the expression level of PD1 antibody was detected by double-sandwich ELISA method.

[0155] It was found that PIK-T cells from three different donors were able to stably express PD1 anti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a killing cell for high-efficiency and stable expression of antibodies and a use thereof. Specifically, the invention provides the transgenic killing cell; a genome of the killing cell is stably integrated with an expression cassette containing an encoding sequence of human Fc segment-containing antibodies, or containing an encoding sequence of chimeric antigen receptors and inhibitory antibodies or activated type antibodies, and both ends of the expression cassette contain inverted terminal repeated sequences of a transposon. The killing cell can stably express the human Fc segment-containing antibodies or the chimeric antigen receptors and antigen-binding fragments derived from interested antibodies with high level while maintaining cell killing toxic effect. In addition, for preventing systemic toxicity and autoimmune diseases caused by over expression of antibodies due to in-vivo continuous proliferation of immune cells for stable expression of the antibodies, a molecular braking system is also introduced. With use of monoclonal antibody agents appearing on the market, the killing cell integrated with the antibody expression cassette can be quickly eliminated, and the safety of treatment is effectively improved.

Description

technical field [0001] The invention belongs to the field of cell biology and oncology, and in particular relates to a killer cell expressing an antibody efficiently and stably and its use. Background technique [0002] Cancer has now become the number one killer of human health. The fast pace of life, huge work pressure, unhealthy eating habits, and poor environment are all accomplices to the occurrence of cancer, making the high incidence and younger trend of cancer more and more obvious. At present, the efficacy of traditional treatment methods has reached the bottleneck, and it is urgent to explore a more effective treatment method to improve the survival rate and quality of life of cancer patients. Immunotherapy against malignant tumors has developed rapidly in recent years and has achieved remarkable clinical efficacy. In 2011, Nature and JCO, the top journal of clinical oncology, respectively published review articles with the same title "The era of tumor immunothera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10A61K35/17A61P35/00A61P31/12A61P31/04A61P37/02C12N15/85
CPCC07K14/70596C07K16/2818C07K16/40C12N5/0636C12N5/0637C12N5/0638C12N5/0646C12N15/85C12N2510/00C12N2800/90C12N2800/107A61K39/4631A61K2239/51A61K39/464404A61K39/464411A61K39/4613A61K2239/49A61K2239/38A61K2239/31A61K2239/55A61K39/464406A61K2239/59A61K39/4636A61K39/4611A61K48/00A61P35/00C07K2317/732C07K16/2887C07K2319/03C07K2319/33A61K39/0005A61K2039/70C07K14/7051C07K2317/622C07K2317/14C07K16/32C07K2317/24C07K2317/73A61K2039/505C07K14/70517C07K14/70521C07K14/71C07K14/4748C07K14/70578C07K2319/02C07K2319/30C07K16/08C07K16/30C07K2317/52C07K2317/76C12N5/10C12N15/8206C12N2310/12
Inventor钱其军金华君胥阶英李林芳叶真龙何周崔连振吴红平
OwnerSHANGHAI CELL THERAPY RES INST