CAR-T cell capable of efficiently and stably expressing activated antibody and application thereof

A cell and antibody technology, applied in the fields of cell biology and oncology, can solve the problems of difficult expression, lack of constant region fragments, and low transfection rate of immune cells

Inactive Publication Date: 2017-12-29
SHANGHAI CELL THERAPY RES INST +1
View PDF10 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] 2. Lack of suitable CAR-T therapeutic targets
[0010] 3. It is difficult to reach an effective amount in the body
[0013] Although there have been reports of transfection of exogenous genes into, for example, T cells, the commonly used gene transfection vector systems have a low transfection rate of effector immune cells with cell killing toxicity, or it is difficult to make exogenous genes in their cells at a high level. Express
The use of adenovirus vectors (non-integrated) can mediate the efficient short-term expression of exogenous genes in T cells, but the proliferation of activated T cells is very fast, and the expression cassettes of exogenous genes carried will be quickly lost during cell passage , the expression is difficult to last; the integration of exogenous genes in the T cell genome can be mediated by retrovirus or lentivirus, and stable expression can be achieved in theory, but the antibody contains light chain and heavy chain, and the coding sequence is long and the molecular weight is large, resulting in Packaging and preparation of retroviruses or lentiviruses carrying full-length antibody expression cassettes is difficult, and it is difficult to express antibodies efficiently (for example, using CAR-T cells to express antibodies, the concentration is only 200ng / ml, Oncotarget.2016Apr 29.doi:10.18632 / oncotarget.9114), generally used to express single-chain antibodies with simple structure (lack of constant region fragments, incomplete function and short half-life)
Therefore, before this, there is no report of CAR-T cells highly expressing antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CAR-T cell capable of efficiently and stably expressing activated antibody and application thereof
  • CAR-T cell capable of efficiently and stably expressing activated antibody and application thereof
  • CAR-T cell capable of efficiently and stably expressing activated antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] Example 1: Construction of recombinant plasmid pNB328-herinCAR-CD28

[0110] According to the herinCAR coding sequence shown in SEQ ID NO: 1 containing the CD20-Rituximab molecular brake (CAR targeting the EGFR family, see CN 201510812654.9) and the herinCAR-CD28 coding sequence shown in SEQ ID NO: 2 (targeting the EGFR family and containing CD20-Rituximab molecular brake CAR and CD28 single-chain-membrane-bound antibody, connected with 2A in the middle), commissioned Shanghai Jereh Biological Company to synthesize, and introduced EcoRI and SalI restriction sites in the upstream and downstream, respectively, and loaded into pNB328 vector , respectively named pNB328-herinCAR, pNB328-herinCAR-CD28.

[0111] HerinCAR coding sequence containing CD20-rituximab molecular brake:

[0112] GCCACCATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGT GGTGGAGGTGGAGGTGGAGGTGGAGGTGGTACCCACTCACTGCCCCCGAGGCCAGCTGCAGTTCCTGTCCCTCTGCGCATGCAGCCTGGCCCAGCCCACCCTGTCCTATCCTTCCTC...

Embodiment 2

[0116] Example 2: Construction of herinCAR-CD28 cells

[0117] Prepare 1×10 7 Freshly isolated peripheral blood mononuclear cells (PBMC) were transfected with 6 μg of pNB328-herinCAR-CD28 and the plasmid into the nucleus through a Lonza 2b-Nucleofector instrument, and placed at 37°C, 5% CO 2 Culture in an incubator; transfer to a 6-well plate containing 30ng / mL anti-CD3 antibody and 3000IU / mL IL-2 (purchased from Novoprotein) after 6 hours, and place at 37°C, 5% CO 2 Incubator culture. After the cells were confluent, they were subcultured at a ratio of 1:5. That is to say, genetically modified T cells that simultaneously express the EGFR family and contain the CD20-rituximab molecular brake CAR and CD28 single-chain antibody, referred to as herinCAR-CD28 cells. At the same time, PBMCs from the same source were transfected with the pNB328-herinCAR plasmid to obtain herinCAR-T cells.

Embodiment 3

[0118] Example 3: Detection of CD28 antibody molecules on the surface of herinCAR-CD28 cells

[0119] Collect the suspended herinCAR-CD28 cells and control herinCAR-T cells constructed in Example 2, and count them at 1×10 6 Each cell / tube was added to two 1.5ml EP tubes, washed twice with PBS, centrifuged at 1200rpm for 5min, and the supernatant was discarded; 2μl of anti-human IgG Fab2' antibody (purchased from Jackson ImmunoResearch Company) was added respectively, and the pellet was flicked to make it Mix well, incubate at room temperature in the dark for 30 minutes, wash once with PBS, centrifuge at 1200 rpm for 5 minutes, discard the supernatant and add 400 μl of normal saline to transfer the cells to a flow tube for detection on the machine. The experimental results found that, compared with the control cells, the surface of herinCAR-CD28 cells had CD28 antibody molecules, specifically as follows: figure 2 shown.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CAR-T cell capable of efficiently and stably expressing an activated antibody and application thereof. Specifically, the genome of the transgenic T cell in the invention is stably integrated with expression cassettes containing nucleic acid sequences coding activated antibodies of chimeric antigen receptors and immune costimulatory molecules or receptors of the immune costimulatory molecules, wherein two ends of the expression cassettes contain inverted terminal repeats of transposons. In the genome of the pluripotent CAR-T cell, the expression cassettes of the activated antibodies are stably integrated via a transposon system, so the CAR-T cell has the activity of stably and efficiently expressing the activated antibodies on the premise that original killing activity of the CAR-T cell is maintained, and transfer-back cells are allowed to rapidly propagate at a tumor site. Meanwhile, a molecular brake system is introduced to ensure the security of CAR-T cell therapy, and transfer-back pluripotent CAR-T cells can be timely removed if necessary.

Description

technical field [0001] The invention belongs to the field of cell biology and oncology, and relates to a CAR-T cell that efficiently and stably expresses an activated antibody and its use. Background technique [0002] Immunotherapy against malignant tumors has developed rapidly in recent years and has achieved remarkable clinical efficacy. Among them, the immune checkpoint (such as CTLA4, PD1 / PDL1) monoclonal antibody therapy plays a role by in situ activation of the patient's residual tumor-specific T cells, and the overall effective rate for a variety of malignant tumors reaches 30%. Efficacy and long-term survival; transgenic CAR-T / TCR-T cell therapy is to quickly obtain tumor-specific T cells through in vitro genetic modification, and then adoptive reinfusion for treatment to play a role in the treatment of relapsed and refractory B-cell leukemia. The remission rate was over 90%. [0003] A chimeric antigen receptor (Chimeric Antigen Receptor, CAR) generally consists ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10A61K35/17A61P35/00A61P31/12A61P31/04A61P37/02C12N15/85
CPCC12N5/0636C12N15/85C12N2510/00C12N2800/107C12N2800/90A61P35/00A61P31/12A61P31/04A61P37/02A61K39/4631A61K2239/59A61K39/4611A61K2239/38A61K39/464404A61K2239/51A61K39/464424A61K48/00C12N5/10
Inventor钱其军金华君胥阶英李林芳叶真龙何周江芏青吴红平
OwnerSHANGHAI CELL THERAPY RES INST