CAR-T cell capable of efficiently and stably expressing activated antibody and application thereof
A cell and antibody technology, applied in the fields of cell biology and oncology, can solve the problems of difficult expression, lack of constant region fragments, and low transfection rate of immune cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0109] Example 1: Construction of recombinant plasmid pNB328-herinCAR-CD28
[0110] According to the herinCAR coding sequence shown in SEQ ID NO: 1 containing the CD20-Rituximab molecular brake (CAR targeting the EGFR family, see CN 201510812654.9) and the herinCAR-CD28 coding sequence shown in SEQ ID NO: 2 (targeting the EGFR family and containing CD20-Rituximab molecular brake CAR and CD28 single-chain-membrane-bound antibody, connected with 2A in the middle), commissioned Shanghai Jereh Biological Company to synthesize, and introduced EcoRI and SalI restriction sites in the upstream and downstream, respectively, and loaded into pNB328 vector , respectively named pNB328-herinCAR, pNB328-herinCAR-CD28.
[0111] HerinCAR coding sequence containing CD20-rituximab molecular brake:
[0112] GCCACCATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGTCCAGTGT GGTGGAGGTGGAGGTGGAGGTGGAGGTGGTACCCACTCACTGCCCCCGAGGCCAGCTGCAGTTCCTGTCCCTCTGCGCATGCAGCCTGGCCCAGCCCACCCTGTCCTATCCTTCCTC...
Embodiment 2
[0116] Example 2: Construction of herinCAR-CD28 cells
[0117] Prepare 1×10 7 Freshly isolated peripheral blood mononuclear cells (PBMC) were transfected with 6 μg of pNB328-herinCAR-CD28 and the plasmid into the nucleus through a Lonza 2b-Nucleofector instrument, and placed at 37°C, 5% CO 2 Culture in an incubator; transfer to a 6-well plate containing 30ng / mL anti-CD3 antibody and 3000IU / mL IL-2 (purchased from Novoprotein) after 6 hours, and place at 37°C, 5% CO 2 Incubator culture. After the cells were confluent, they were subcultured at a ratio of 1:5. That is to say, genetically modified T cells that simultaneously express the EGFR family and contain the CD20-rituximab molecular brake CAR and CD28 single-chain antibody, referred to as herinCAR-CD28 cells. At the same time, PBMCs from the same source were transfected with the pNB328-herinCAR plasmid to obtain herinCAR-T cells.
Embodiment 3
[0118] Example 3: Detection of CD28 antibody molecules on the surface of herinCAR-CD28 cells
[0119] Collect the suspended herinCAR-CD28 cells and control herinCAR-T cells constructed in Example 2, and count them at 1×10 6 Each cell / tube was added to two 1.5ml EP tubes, washed twice with PBS, centrifuged at 1200rpm for 5min, and the supernatant was discarded; 2μl of anti-human IgG Fab2' antibody (purchased from Jackson ImmunoResearch Company) was added respectively, and the pellet was flicked to make it Mix well, incubate at room temperature in the dark for 30 minutes, wash once with PBS, centrifuge at 1200 rpm for 5 minutes, discard the supernatant and add 400 μl of normal saline to transfer the cells to a flow tube for detection on the machine. The experimental results found that, compared with the control cells, the surface of herinCAR-CD28 cells had CD28 antibody molecules, specifically as follows: figure 2 shown.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com