A highly efficient CRISPR/Cas9 gene editing system optimized for Kluyveromyces

A Kluyveromyces and gene technology, applied in the field of CRISPR/Cas9 high-efficiency gene editing system, can solve the problems of Kluyveromyces industrial production safety hazards, unstable replication and expression, etc., and achieve the effect of safe gene editing

Active Publication Date: 2018-07-10
KANGMA SHANGHAI BIOTECH LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, usually the plasmid of Saccharomyces cerevisiae is a 2µ plasmid (including pCAS), which cannot be stably replicated and expressed in Kluyveromyces[11]
In the Kluyveromyces CRISPR / Cas9 transformation system reported so far, the Cas9 gene is directly inserted into the yeast genome, resulting in continuous expression of the Cas9 protein, which poses a certain safety hazard to the industrial production of Kluyveromyces[12]. An efficient and safe CRISPR / Cas9 system capable of stably replicating and expressing in Kluyveromyces is necessary for the development of biotechnology and will be a great advancement in the field of biomedicine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A highly efficient CRISPR/Cas9 gene editing system optimized for Kluyveromyces
  • A highly efficient CRISPR/Cas9 gene editing system optimized for Kluyveromyces
  • A highly efficient CRISPR/Cas9 gene editing system optimized for Kluyveromyces

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1—KL-CAS1.0 System Transformation

[0036] pKM-Cas9 / gRNA plasmid construction

[0037] In the prior art, the pCAS plasmid used in Saccharomyces cerevisiae has both Cas9 gene sequence and gRNA elements, which can realize efficient genome transformation in Saccharomyces cerevisiae through one transformation, but cannot stably replicate and express in Kluyveromyces cerevisiae, such as figure 1 shown. Through transformation, the present invention constructs a new safe and efficient CRISPR / Cas9 gene editing system that is dedicated to Kluyveromyces, can be stably replicated, expressed, and genetically modified in Kluyveromyces, and the gene editing system is named It is KL-CAS1.0. The Kluyveromyces of the present invention is illustrated by taking Kluyveromyces lactis as an example, but not limited thereto.

[0038] Insertion of KL-CAS1.0 efficient pKD1 stabilizing element (SE)

[0039] pKD1 is a commonly used plasmid for Kluyveromyces transformation [13]. In or...

Embodiment 2

[0049] 2. Example 2—Determination of target gene and gRNA sequence

[0050] 2A. Kluyveromyces lactis target gene identification

[0051] Sequence search at http: / / www.uniprot.org / , species" Kluyveromyceslactis ",Key words" Threoninet RNA synthetase "" ThrRS "" TRS ". Here, inserting a marker DNA at the tail of this gene is taken as an example. Other target genes or insertion positions and sequences can be operated in a similar manner.

[0052] i. There are two kinds of TRS in K. lactis, which exist in the cytoplasm and mitochondria respectively. After the protein sequence is retrieved, analyze it on the website https: / / ihg.gsf.de / ihg / mitoprot.htmL to determine whether the retrieved protein exists in the cytoplasm (without mitochondrial recognition sequence, eukaryotic homology) or in mitochondria (with mitochondria recognition sequence, prokaryotic homology), pick cytoplasmic TRS Gene (http: / / www.uniprot.org / uniprot / Q6CL41) as the target gene, and named as Kl-TRS ...

Embodiment 3

[0056] 3. Example 3—target sequence pKM-Cas9 plasmid construction

[0057]The present invention replaces the gRNA sequence in the original plasmid with the PCR-homologous recombination method Kl - TRS gRNA sequence. The specific steps are: using the pKM-CAS1.0 plasmid as a template, using primers pKM-Cas9-TRS-F1:CTTTCTGATAATGTCTTGGCTTAAGTTTTAGAGCTAGAAATAGCAAG and primers pKM-Cas9-TRS-R1:GCTCTAAAACTTAAGCCAAGACATTATCAGAAAGTCCCATTCGCCAC for amplification. Mix 17 µL of amplification product, 1 µL of LDpn I, 2 µL of 10×digestion buffer, 37 o C warm bath for 3 h. Add 10 µL of Dpn I-treated product to 100 µL DH5α competent cells, place on ice for 30 min, 42 o After heat shock at C for 45 s, add 1 mL of LB liquid medium37 o C cultured with shaking for 1 h, spread on Amp-resistant LB solid culture, 37 o C was cultured upside down until a single clone grew out. Pick 5 single clones and shake them in LB liquid medium. After the PCR test is positive and confirmed by sequencing, ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a CRISPR / Cas9 safe and efficient gene editing system specially optimized for Kluyveromyces, belonging to the field of biotechnology. In the prior art, the pCAS plasmid used in Saccharomyces cerevisiae has both the Cas9 gene sequence and the gRNA element, which can realize efficient genome transformation in Saccharomyces cerevisiae through one transformation, but cannot stably replicate and express in Kluyveromyces cerevisiae. The present invention transforms the Cas9 / gRNA fusion plasmid into Kluyveromyces cells, and the plasmid targets the endogenous DNA sequence of Kluyveromyces cells, and produces a double-stranded nick; transforms the donor DNA sequence into Kluyveromyces cells, and the The sequence generates homologous recombination with the target site at the double-stranded cut, and the Tag sequence is inserted into the target site. Through transformation, the present invention constructs a new safe and efficient CRISPR / Cas9 gene editing system that is dedicated to Kluyveromyces and can be stably replicated, expressed, and genetically modified in Kluyveromyces.

Description

technical field [0001] The invention relates to a CRISPR / Cas9 high-efficiency gene editing system specially optimized for Kluyveromyces, belonging to the field of biotechnology. Background technique [0002] Microbial genome modification mainly relies on two biological mechanisms: endogenous homologous recombination repair (endogenous homology-directed repair, HDR) and non-homologous end joining (non-homologous end joining, NHEJ) [1]. The basic process of HDR is that after double-strand breaks (DSBs) occur in the genome, the donor DNA (sequence homologous to the sequences on both sides of the break site) undergoes homologous recombination with the damaged genome sequence at the break site , to achieve repair, this process is not easy to introduce insertion or deletion mutations [2]. The basic process of NHEJ is that the two ends of the broken DNA are directly joined without the aid of homologous recombination mediated by the donor DNA. This process is prone to insertion or ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/81C12N1/19C12R1/645
CPCC12N15/81C12N1/145C12R2001/645
Inventor郭敏代田纯李海洋于雪
OwnerKANGMA SHANGHAI BIOTECH LTD