Recombinant adenovirus expressing anticancer peptide CB1a as well as construction method and application thereof

A technology of recombinant adenovirus and anticancer peptide, applied in the application field of medicine, can solve the problems of unstable structure, easy degradation of polypeptide medicine, high cost of chemical synthesis, simple construction method, inhibition of migration and growth, and repeatability. strong effect

Inactive Publication Date: 2018-03-20
WUHAN INST OF BIOENG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, anticancer peptides become clinically used anticancer drugs, but they face problems such as high chemical synthesis costs, unstable structures, and peptide drugs are easily degraded.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus expressing anticancer peptide CB1a as well as construction method and application thereof
  • Recombinant adenovirus expressing anticancer peptide CB1a as well as construction method and application thereof
  • Recombinant adenovirus expressing anticancer peptide CB1a as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The features and advantages of the present invention can be further understood through the following detailed description in conjunction with the accompanying drawings. The examples provided are only illustrative of the method of the present invention and do not limit the rest of the present disclosure in any way. [Example 1] Obtaining the target gene CB1a

[0051] 1. Primer design

[0052] Look up the amino acid sequence of CB1a on NCBI, and design and optimize the gene sequence using human-preferred codons. The optimized sequence is as follows:

[0053] ATGAAGTGGAAGGTGTTCAAGAAGATCGAGAAGAAGTGGAAGGTGTTCAAGAAGATCGAGAAGGCCGGCCCCAAGTGGAAGGTGTTCAAGAAGATCGAGAAGTGA (SEQ ID NO: 1).

[0054] Amino acid sequence of CB1a (MMDB ID: 144618):

[0055] KWKVFKKIEK KWKVFKKIEKAGPKWKVFKKIEK (SEQ ID NO: 1).

[0056] According to the above gene sequence, Primer Premier 5 was used to design overlapping PCR primers. In the second amplification primer, an EcoR I restriction site was added...

Embodiment 2

[0068] [Example 2] Preparation of recombinant adenovirus carrying CB1a gene

[0069] 1. Construction of recombinant adenovirus gene vector

[0070] 1.1 Construction and identification of pMD-20T-CB1a vector

[0071] CB1a and pMD-20T vector connection system: Solution I 5 μL, pMD-20T vector 0.5 μL, overlapping CB1a recovery product 2.6 μL, ddH 2 O 1.9 μL.

[0072] The ligated system was placed in a thermostat at 16°C overnight. EcoR I, Xba I double enzyme digestion identification, the reaction product is electrophoresed with 1% agarose gel (such as figure 2 , about 100bp band is the CB1a gene). Sequencing identification was performed by Wuhan Sequencing Department of Sangon Bioengineering (Shanghai) Co., Ltd.

[0073] 1.2 Construction and identification of pAdTrack-CB1a shuttle vector

[0074] The correct pMD-20T-CB1a and pAdTrack-CMV were digested with EcoR I and Xba I at the same time, and CB1a was recovered by agarose gel electrophoresis, and the linearized pAdTrack-C...

Embodiment 3

[0119] [Example 3] Detection of inhibition of cancer cells

[0120] 1. MTT detection of recombinant adenovirus infected cancer cells

[0121] ① Place 5000 cancer cells / well into a 96-well plate at 37°C, 5% CO 2 Cultivate for 12h.

[0122] ② Add viruses with different multiplicity of infection, and set 5 replicates for each multiplicity of infection.

[0123] ③ Add 20 μL MTT (5 mg / mL) to culture for 48 hours, 72 hours, and 96 hours respectively, and culture for 4 hours; then remove the medium, add 200 μL DMSO to completely dissolve the purple crystals, measure the absorbance at 490 nm, and Record data to analyze cell viability. SCC9 cells (such as Figure 5 ), LN229 cells (such as Figure 6 ), U87 cells (such as Figure 7 ), A549 cells (such as Figure 8 ) experiment, the results showed that the inhibitory effect after 72h and 48h after adding the recombinant adenovirus was significantly higher than that of the control group, and the different MOIs were slightly differen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant adenovirus expressing an anticancer peptide CB1a as well as a construction method and application thereof. According to the invention, the anticancer peptide CB1ais taken as a target gene to construct a recombinant adenovirus vector, and eukaryotic expression of the anticancer peptide CB1a is realized. By virtue of detection on relative activity on MTT cellsand a cell scratch assay, CB1a is verified to have the effect of inhibiting activity and migration of cancer cells in an in vitro experiment, so that growth of the cancer cells is inhibited. The construction method disclosed by the invention is high in efficiency and yield, and an unreported gene therapy system resistant to tumor cell migration and growth is provided.

Description

technical field [0001] The invention relates to a method for constructing a recombinant adenovirus, specifically, a method for constructing a recombinant adenovirus by using an anticancer peptide CB1a gene, and the application of the recombinant adenovirus and a drug for inhibiting the activity of tongue cancer cells. Background technique [0002] With the increasing proportion of the global cancer prevalence year by year, cancer has become the leading cause of death and a major public health problem worldwide. Significant advances have been made in human cancer research and treatment over the past few decades. However, the effect of traditional cancer treatment is not satisfactory. Most chemotherapy drugs are lethal to cancer cells but also to healthy and fast-dividing cells, and also suppress the immune system. There are also cancer drug resistance and tumor area Insufficient drug concentration and other problems. This greatly reduces their therapeutic efficacy, and the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/861A61K48/00A61P35/00A61P35/04
Inventor张军林岳硕豪龚仕涛赖晓晶谢立兰解举民郭晓红李毅
OwnerWUHAN INST OF BIOENG