Unlock instant, AI-driven research and patent intelligence for your innovation.

Long oyster interferon regulatory factor cgirf-1 gene recombinant protein, preparation method and application

A technology of regulating factors and gene recombination, applied in the field of molecular biology

Active Publication Date: 2021-05-11
DALIAN OCEAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, so far there is no information about the long oyster interferon regulator CgIRF-1 Relevant reports on gene recombinant protein, preparation method and application in preparation of immune enhancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long oyster interferon regulatory factor cgirf-1 gene recombinant protein, preparation method and application
  • Long oyster interferon regulatory factor cgirf-1 gene recombinant protein, preparation method and application
  • Long oyster interferon regulatory factor cgirf-1 gene recombinant protein, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0039] Experimental example 1: long oyster interferon regulatory factor of the present invention CgIRF-1 In vitro binding activity detection of gene recombinant protein and ISRE

[0040] Specific steps are as follows:

[0041] (1) Synthesis without biotin labeling

[0042] ISRE (ISRE-WT (forward): TGCAGGGAAACTGAAACTAAT;

[0043]ISRE-WT(reverse): ATTAGTTTCAGTTTCCCTGCA),

[0044] Biotinylated ISRE (ISRE-Bio (forward):

[0045] biotin-TGCAGGGAAACTGAAACTAAT;

[0046] ISRE-Bio (reverse): biotin-ATTAGTTTCAGTTTCCCTGCA);

[0047] Mutated ISRE not biotinylated (ISRE-MU (forward):

[0048] TGCAGGCAAACTCAAACTAAT;

[0049] ISRE-MU (reverse): ATTAGTTTGAGTTTGCCTGCA) oligonucleotide chain.

[0050] (2) Dissolve and dilute the non-biotinylated synthetic ISRE and non-biotinylated mutated ISRE to 100 μM with annealing buffer, and take an equal amount of forward and reverse strands after dissolving and diluting the biotinylated ISRE to 10 μM Probes were annealed (95 °C, 5 min, slowly co...

experiment example 2

[0053] Experimental example 2: long oyster interferon regulatory factor of the present invention CgIRF-1 Gene recombination protein promotes transcriptional activity analysis of CgIFNLP promoter region in HEK293T cells.

[0054] (1) Use the coding region of the long oyster interferon regulatory factor 1 (CgIRF-1) gene as a template, and use primers P3 and P4 to amplify and wait for use;

[0055] (2) Kpn I and Xho I were used to digest the above PCR product and pcDNA3.1 (+) plasmid, and the digested fragments were ligated by T4 ligase, transformed, sequenced and identified as recombinants.

[0056] (3) Using the non-coding region of the upstream 1000 bp gene of long oyster interferon protein (CgIFNLP) as a template, the primers P5 and P6 were used to amplify and set aside;

[0057] (4) Use Kpn I and Xho I to digest the above PCR product and pGL3 basic, and the digested fragments are ligated by T4, transformed, and sequenced to identify recombinants;

[0058] (5) All plasmids,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a long oyster interferon regulatory factor CgIRF‑1 Gene recombinant protein, the amino acid sequence is shown in SEQ ID NO.1. The preparation method is carried out according to the following steps in sequence: using primers P1 and P2 to synthesize the long oyster interferon regulatory factor CgIRF‑1 The fragment of the gene coding region was amplified by PCR; Nde I, Xho I After digestion, the recombinants were ligated by ligase, transformed, and sequenced to identify the recombinants; the above-mentioned recombinants were transferred into Escherichia coli BL21 (DE3) expression strains for induction and culture, and then purified and renatured. The long oyster interferon regulatory factor CgIRF‑1 Gene recombinant protein can be applied to prepare immune enhancer.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, in particular to a long oyster interferon regulatory factor CgIRF-1 Gene recombinant protein, preparation method and application. Background technique [0002] The long oyster is an important marine cultured shellfish. Because the long oyster lacks an adaptive immune defense system and mainly relies on the innate immune system to resist the infection of exogenous pathogenic microorganisms, various diseases caused by bacteria, fungi and viruses continue to break out in the long oyster farming population, causing huge economic losses. loss. [0003] Interferon (IFN) is a class of cytokines that can resist viral infection, inhibit cell cycle and perform immune regulation functions. Interferon regulatory factors (IRFs) are important transcription factors that regulate the expression of interferon (IFN), interferon-stimulated gene (ISG) and other related genes. It combines with the DNA s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/70A61K38/17A61P37/04
CPCA61K38/00C07K14/43504
Inventor 宋林生鹿蒙蒙杨传燕王玲玲宋小瑞
Owner DALIAN OCEAN UNIV