Palaemon carinicauda embryo micro-injection method and building of mRNA overexpression model by using method

A technology of microinjection and white shrimp, applied in the field of gene editing, can solve the problems of lack of research on gene editing of crustaceans

Inactive Publication Date: 2018-05-25
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to solve the problem of lack of gene editing research in crustaceans, and to provide a microinjection method of spinytail shrimp embryos and its utilization method to construct an in vitro transcription model

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Palaemon carinicauda embryo micro-injection method and building of mRNA overexpression model by using method
  • Palaemon carinicauda embryo micro-injection method and building of mRNA overexpression model by using method
  • Palaemon carinicauda embryo micro-injection method and building of mRNA overexpression model by using method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Embodiment 1: Microinjection method of white shrimp embryo

[0020] 1) Selection of spinytail shrimp and fertilized eggs

[0021] In the microinjection experiments, the shrimps used were healthy adult white shrimp (E. carinicauda), with an average body length of 5.5±0.5 cm. The shrimps used in the experiment were continuously aerated and cultured in natural seawater. The water was changed and bait was fed every day. The water temperature was maintained at 24°C. The white shrimp with mature gonads was selected for the experiment. According to the characteristics of each developmental stage of fertilized eggs of white shrimp, combined with the success rate of microinjection experiments, the injection success rate before the 8-cell stage is relatively high, and the injection survival rate at the single-cell stage is the highest; injection after the 8-cell stage is difficult, and the injection needle is easy to use. broken; therefore, the selection of fertilized eggs at th...

Embodiment 2

[0031] Example 2: Construction of a model by microinjection of spinytail shrimp embryos

[0032] (1) Construction of SP6-EGFP DNA template

[0033] The EGFP sequence was inserted between the multiple cloning sites EcoR I and Not I of the commercialized plasmid pIZT / V5-His (Invitrogen, USA) to construct the pIZT / V5-EGFP recombinant plasmid. According to the sequence of pIZT / V5-EGFP, the forward primer SP6-EGFP-F and the reverse primer SP6-EGFP-R were designed, and the SP6 promoter site was added in the forward primer.

[0034] The primer sequences are as follows:

[0035] SP6-EGFP-F:gc ATTTAGGTGACACTATAGAAACAG ATGGTGAGCAAGGGCGAGGA (single underline is the SP6 promoter sequence)

[0036] SP6-EGFP-R: CGCGCTTGAAAGGAGTGTGTA

[0037]Use primers SP6-EGFP-F and SP6-EGFP-R to amplify the EGFP sequence in the pDHSP70-EGFP-His plasmid, and the PCR reaction system is:

[0038]

[0039] PCR cycle program such as: 98°C pre-denaturation for 1min; 98°C for 10sec, 59°C for 5sec, 72°C ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a palaemon carinicauda embryo micro-injection method and building of an mRNA overexpression model by using themethod. Micro-injection is conducted on a palaemon carinicauda unicellular-stage embryo under a hyperosmosis micro-injection system and a certain micro-injection condition. The palaemon carinicauda model overexpressing mRNA is built up by taking in vitro transcription mRNA as an injection material and adopting the palaemon carinicauda embryo micro-injection method. Expression of in virtro transcription EGFPmRNA in the palaemon carinicauda embryo is successfully achieved by adopting the method. Building of the palaemon carinicauda embryo micro-injection method and application of the palaemon carinicauda embryo micro-injection method to building of an mRNA overexpression model have important theoretical meaning and practical meaning for conducting research on functional genes and the gene editing of shelled animals such as shrimps.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and specifically relates to a method for microinjection of white shrimp embryos and using the method to construct an mRNA overexpression model. Background technique [0002] Mariculture is an important part of blue agriculture. How to obtain more and better mariculture species has always been an important content of research by scientists at home and abroad. At the same time, the development of social economy and the demand for product diversification have also put forward higher requirements for the improvement of marine biological germplasm. Taking prawns as an example, prawns are an important species of mariculture in my country and occupy an important position in marine fisheries. Chinese scientists have bred new varieties of Chinese prawns "Huanghai No. 1", "Huanghai No. 2", and Litopenaeus vannamei "Kehai No. 1" through traditional breeding methods, and some new varieties have been i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89C12N15/873A01K67/033
CPCA01K67/0338A01K2227/70A01K2267/0393C12N15/873C12N15/89
Inventor张继泉宋凤阁桂天书相建海
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI