Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of male sterility gene OsDPW3 and rice fertility restoration method

A technology of male sterility gene and male sterility, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the limitation of restorer line and maintainer line relationship, the difficulty of screening excellent combinations, and the complex performance of three-line hybrid rice seeds. and other issues to achieve the effect of improving production efficiency and reducing labor costs

Active Publication Date: 2018-06-08
SHANGHAI JIAO TONG UNIV
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male sterility gene OsDPW3 and rice fertility restoration method
  • Application of male sterility gene OsDPW3 and rice fertility restoration method
  • Application of male sterility gene OsDPW3 and rice fertility restoration method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, the method of rice male sterile line creation

[0044] 1.1 Creation of osdpw3 rice male sterile line by conventional breeding methods

[0045] The osdpw3-1 mutant material in this example is obtained from a conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through a conventional genetic engineering method.

[0046] Those skilled in the art know that other methods such as irradiation can also be used to mutate conventional rice varieties. If the osdpw3-1 mutant is mutated, it will lead to frameshift and premature termination of the encoded protein, which will also lead to male reproduction in rice. Organ anthers do not develop normally. The mutagenized mutants were backcrossed for three generations to obtain a stably inherited osdpw3-1 mutant controlled by a recessive nuclear single gene. The osdpw3-1 mutant was backcrossed with 9522, and all F1 generations had the same phenotype as 9522 and appeared fertile. The segregation ratio ...

Embodiment 2

[0069] Example 2. Use of osdpw3 mutants in rice seed production

[0070] The osdpw3-1 mutant was crossed as the male parent with the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. Plants with both male-sterile and sterile characteristics are selected in the F2 generation, and the plants are crossed with the maintainer line corresponding to the original sterile parent. The plants with both male sterility and sterility are screened again in the F2 generation to cross with the maintainer line, and a new male sterile line is obtained after multi-generation cross screening, which is suitable as the female parent in the hybrid combination.

Embodiment 3

[0071] Example 3. Method for restoring male sterility of osdpw3 mutants

[0072] The genomic nucleotide sequence encoding the OsDPW3 gene was transformed into the osdpw3-1 mutant plant, which could restore the mutant to the wild-type phenotype.

[0073] Genomic DNA was extracted from leaves of wild-type 9522 seedlings as template, using primers:

[0074] 70025gDNAF (its sequence is shown in SEQ ID NO. 7):

[0075] CCATGATTAC GAATTC TATTGCCTGTTTGTGGCTGGAC;

[0076] 70025gDNAR (its sequence is shown in SEQ ID NO. 8):

[0077] ATTCGAGCT GGTCACC GCCGCTTACACGTTACTGTATTGG;

[0078] Amplify the genome sequence fragment of 9120bp as shown in SEQ ID NO.6 of the OsDPW3 gene;

[0079] The amplified DNA fragment was inserted into the binary vector pCAMBIA1301 vector used for rice transformation through the In-Fusion transformation system of Dalian Bao Bio Co. ) EHA105 to obtain OsDPW3 complementary Agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105, and use genetic tr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a male sterility gene OsDPW3 and a rice fertility restoration method. The gene OsDPW3 is knocked out, changed or inhibited by using the conventional genetic engineering method or based on a CRISPR / Cas9 system, and the OsDPW3 gene expression level is decreased in wild type rice with japonica rice background, so that a rice male sterile line is further obtained. The invention also relates to the rice fertility restoration method. According to the method, the OsDPW3 gene is amplified by means of primers, and mutant plants are transformed by using a genetic transformation means, so that the mutant can be restored to a wild-type phenotype. The rice male sterility line prepared by the method has no abnormal phenotype in the rice vegetative growth period, but abnormality occurs in an anther development process of the reproductive growth period. If the rice male sterility line is applied to cross breeding, the work of castration of a female parent can beeliminated, so that the production efficiency is greatly improved, and the labor cost is lowered. The male sterility gene OsDPW3 has important application to agricultural production.

Description

technical field [0001] The invention relates to a method for creating a rice line in the field of bioengineering technology, in particular to an application of a male sterility gene OsDPW3 and a method for restoring rice fertility. Background technique [0002] Rice is an important food crop in the world. About 50% of the world's population eats rice as the staple food. Rice is also the raw material for processing many foods. Because the genome of rice is small and the rice transformation system is very mature, it can be used as a model plant for monocotyledonous research. The mechanism of rice reproduction and development remains to be understood. The discovery and utilization of rice male sterile line has opened up a new era of rice hybrid breeding, which has played a huge role in improving rice yield. Since the sterile lines used in the current rice hybridization process have shortcomings such as unstable fertility and negative cytoplasmic effects, it is of great signifi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/46A01H1/02
CPCA01H1/02C07K14/415C12N15/8213C12N15/8289
Inventor 梁婉琪张大兵徐大伟袁政
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com