Overexpression of cox5a/low expression of bdnf transgenic mouse model and its construction method and application
A construction method and technology of transgenic mice, applied in the field of overexpression COX5A/low expression BDNF transgenic mouse model and its construction, can solve the problems such as unclear mechanism of mitochondrial defects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Example 1 Construction of overexpressed COX5A transgenic mouse model:
[0075] The construction method includes the following steps:
[0076] Step 1, PCR cloning and amplification of the open reading frame (ORF) of the target gene COX5A (GeneID: 12858), the amplification primer sequences are as follows:
[0077] The upstream primer is 5'GTCAATGGGTGGAGTATTTACG 3', the nucleotide sequence of which is shown in SEQ ID NO.1;
[0078] The downstream primer is 5'GCTTATATAGACCTCCCCACCGT 3', the nucleotide sequence of which is shown in SEQ ID NO.2; the target fragment is 386bp.
[0079] Step 2, pcDNA3.1(+)-m-COX5A plasmid construction. After digestion, recovery of DNA fragments, and ligation reaction, restriction enzymes EcoRI and XhoI were used to digest the pcDNA3.1(+ / -) Vector vector and the ORF of the inserted target fragment COX5A. Such as figure 1 shown in a-b.
[0080] Step 3, transfer the constructed plasmid vector into strains to extract DNA, prepare plasmid DNA in...
Embodiment 2
[0095] Example 2 Construction of a low-expression BDNF transgenic mouse model:
[0096] Include the following experimental steps:
[0097] Step 1. Construction of CMV-EmGFP-siRNA-BDNF low-expression transgene fragment: the silent expression vector CMV-EmGFP-siRNA-BDNF was purchased from Invitrogen, and the target gene BDNF[BDNF brain derived neurotrophic factor( Mus musculus), GeneID: 12064], the target site is (CCAAGTGTAATCCCATGGGTT), a silent plasmid was designed, and then the plasmid construction was completed by Zhongmeitaihe Company.
[0098] Step 2. The constructed silencing plasmid is transfected into 293T cells, and then the RT-PCR method is used to screen out the construction with a good silencing effect, such as image 3 As shown, compared with the control group and the other three interfering plasmids, the expression of BDNF in the cells transfected with the BDNF low-expression transgenic plasmid No. 47 was significantly reduced, which was reserved for subsequent u...
Embodiment 3
[0110] Example 3 Construction of Overexpression COX5A / Low Expression BDNF Transgenic Mouse Model (COX5A-UP / BDNF-DO)
[0111] The COX5A overexpression line Founder 35 and the BDNF low expression line Founder 39F1 generation were caged together, and COX5A overexpression and BDNF low expression double hybrid mice were obtained from the progeny mice. Generation of mice, genotype detection of offspring mice, PCR method detects COX5A overexpression transgenic mouse genotype and BDNF low expression transgenic mouse genotype fragments in mouse tail genomic DNA at the same time, that is, mice with overexpression of COX5A and low expression of COX5A Two-hybrid mice expressing BDNF.
[0112] Depend on Figure 6 It can be seen that the above two fragments were detected simultaneously in the tail DNA of the transgenic mice, indicating that the double-hybrid mice with overexpression of COX5A and low expression of BDNF were successfully constructed.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More