Unlock instant, AI-driven research and patent intelligence for your innovation.

Loop-mediated isothermal amplification (LAMP) quantitative method based on fluorescence quantitative system

A technology of fluorescent quantification and fluorescent dyes, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of narrow application range and high instrument cost of turbidimeter, and achieve high sensitivity, good repeatability, and simple operation Effect

Pending Publication Date: 2018-08-10
厦门蓝特生物科技有限公司 +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, LAMP technology is mostly used in qualitative experiments, and can also detect by-product magnesium pyrophosphate precipitation by turbidimeter, so as to achieve the purpose of gene quantification indirectly. The application range of turbidimeter required by this method is relatively narrow, and the cost of the instrument is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Loop-mediated isothermal amplification (LAMP) quantitative method based on fluorescence quantitative system
  • Loop-mediated isothermal amplification (LAMP) quantitative method based on fluorescence quantitative system
  • Loop-mediated isothermal amplification (LAMP) quantitative method based on fluorescence quantitative system

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0020] Specific example 1: qLAMP uses Evagreen dye and SYTO-82 dye concentration optimization

[0021] Experimental materials: Clostridium difficile (Clostridium difficile, ATCC 43255) was cultured overnight, and DNA was extracted for future use. The primers used are as follows:

[0022] tcA -F3: GCCATATTYTTTAGATTCAGACAA

[0023] tcA -B3: CTAAAAAAAGAAYTAGAAGCTAAGG

[0024] tcA - FIP: GCTGGTATATCTGCRGGAATACYTRTTTACCACTGAAGTTGCCTT

[0025] tcA -BIP:TTCAGCACCTATTCCAACAATTGAGGGTGTTTTAGCAATAAATATGTCA

[0026] tcA -LB:AGCTACMGTTGCAGCTATAGA

[0027] Experimental method: optimization of Evagreen dye concentration, the optimized concentration gradient is: 0.2X, 0.6X, 1.0X, 1.4X, 1.8X, 2.2X;

[0028] For the optimization of SYTO-82 dye concentration, the optimal concentration gradient of LAMP is: 45μM, 35μM, 25μM, 15μM, 5μM, 2.5μM;

[0029] The dye-optimized LAMP quantification system is: a total volume of 20 μL, including: 1x Thermopol buffer (20 mM Tris-HCl, (pH8.8), 10 mM ...

specific Embodiment 2

[0031] Specific example 2: Based on Evagreen dye and SYTO-82 dye, establish and detect Clostridium difficile tcA Gene standard curve.

[0032] Experimental materials: Clostridium difficile (Clostridium difficile, ATCC 43255) was cultured overnight, and the DNA was extracted for later use. Two commonly used fluorescent dyes: Evagreen and SYTO-82 were used to perform fluorescence quantitative experiments on the tcdA gene of Clostridium difficile. The primers used are as follows:

[0033] tcA -F3: GCCATATTYTTTAGATTCAGACAA

[0034] tcA -B3: CTAAAAAAAGAAYTAGAAGCTAAGG

[0035] tcA - FIP: GCTGGTATATCTGCRGGAATACYTRTTTACCACTGAAGTTGCCTT

[0036] tcA -BIP:TTCAGCACCTATTCCAACAATTGAGGGTGTTTTAGCAATAAATATGTCA

[0037] tcA -LB:AGCTACMGTTGCAGCTATAGA

[0038]Experimental method: Extract Clostridium difficile DNA and dilute the DNA sample to 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, 1fg / μL. Using these samples as templates, fluorescent quantitative amplification wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a loop-mediated isothermal amplification (LAMP) quantitative method based on a fluorescence quantitative system. The method can realize LAMP quantification by using a fluorescence quantitative polymerase chain reaction (PCR) instrument; an LAMP technology is combined with a fluorescence quantification technology, so that the LAMP quantitative method based on the fluorescence quantitative system is established; after the method is adopted, the purpose of quantification can be achieved; furthermore, the method is simple to operate, high in sensitivity and good in repeatability, and enables LAMP detection to be more accurate and convenient. A new direction is opened up for realizing the accurate quantification of LAMP.

Description

technical field [0001] The invention belongs to the field of gene quantification, and more specifically relates to a quantitative method for LAMP based on a fluorescent quantitative system. Background technique [0002] Loop-mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) is a new nucleic acid amplification technology proposed by Japanese scientist Notomin in 2000. It uses Bst DNA polymerase and 4-6 primers to directly amplify the target fragment through strand displacement reaction at 60-65°C, and the reaction time is only 15-60min. LAMP technology has been widely used in the detection of pathogenic microorganisms in recent years. [0003] At present, LAMP technology is mostly used in qualitative experiments, and can also be used to detect by-product magnesium pyrophosphate precipitation through turbidimeter, so as to indirectly achieve the purpose of gene quantification. The application range of turbidimeter required by this method is rela...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2563/107C12Q2531/119
Inventor 杨璐溪李晓燕
Owner 厦门蓝特生物科技有限公司