Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quality detection method of Dendrobium nobile Lindley

A quality inspection method and technology of Dendrobium candidum, applied in measurement devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, effectively identify and control quality, and solve problems. Effects of the curse of dimensionality

Active Publication Date: 2018-08-14
北京蓝标一成科技有限公司
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In traditional Chinese medicine under the guidance of traditional Chinese medicine theory, any active ingredient cannot fully reflect the overall curative effect of traditional Chinese medicine.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quality detection method of Dendrobium nobile Lindley
  • Quality detection method of Dendrobium nobile Lindley
  • Quality detection method of Dendrobium nobile Lindley

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 First-generation sequencing of Dendrobium nobile

[0053] First generation sequencing primer sequence:

[0054] ITS-26SE: 5’GAATTCCCCGGTTCGCTCGCCGTTAC 3’;

[0055] ITS-17SE: 5’ACGAATTCATGGTCCGGTGAAGTGTTCG 3’.

[0056] The amplification and sequencing parameters are: PCR cycle after denaturation at 98°C for 2min. PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min. After amplification, set 4°C to keep warm and proceed. First-generation molecular sequencing.

[0057] Through the first generation sequencing, the species of Dendrobium nobile to be tested was identified as Dendrobium nobile.

Embodiment 2

[0058] Example 2 Extraction method of Dendrobium nobile

[0059] Take a dried sample of Dendrobium nobile, crush it with a grinder, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (weighing error cannot exceed 0.2%), place it in a 100ml conical flask, and add 50mL 75 % Methanol (V water:V methanol=25:75), ultrasonic for 30min at room temperature, take it out, filter, the filtrate is concentrated to dryness by rotary evaporation, dissolved in 75% methanol solvent (V water:V methanol=25:75), and finally transferred Place the volume in a 10ml volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium nobile.

Embodiment 3

[0060] Example 3 Chromatographic detection method of Dendrobium nobile extract

[0061] ① Preparation of reference solution

[0062] Weigh 4.10mg of Schafertoside and 4.08mg of Naringenin respectively, put them in a 10ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, shake well, and use as stock solution. Refrigerate in a refrigerator at 4℃ for later use.

[0063] Then accurately draw a certain amount of reference substance stock solution, dilute with 75% methanol, and accurately prepare the mixed reference substance solution of Schafertoside and naringenin. Seven concentration points are prepared by diluting the ingredients through different dilution ratios. Inject into the high performance liquid chromatograph.

[0064] ②Determination of the content of small molecules in Dendrobium nobile. Sample extraction and processing methods:

[0065] Take 1.00g of this product powder (pass the No. 3 sieve), accurately weigh it, place it in a 100ml volumetric flask, add 50ml ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quality detection method of Dendrobium nobile Lindley. The quality detection method comprises: 1) sequencing by using ITS-26SE and ITS-17SE as primers to identify the varietyof a to-be-detected Dendrobium herb; 2) carrying out chromatographic detection on n samples to obtain detection data using a chemical small molecule component schaftoside and / or naringenin as a reference component; 3) respectively carrying out fingerprint detection on the samples to obtain the fingerprint peak area value of the full chemical components of Dendrobium nobile Lindley; and 4) establishing an analysis model by using the content value of the schaftoside and / or naringenin in the chromatographic data as the response variable and using the peak area value of other components in the fingerprint as the independent variable, screening the variable through a Lasso method, and establishing the characteristic fingerprint model related to the chemical small molecule component. Accordingto the present invention, through the first-generation sequencing and the characteristic fingerprinting, the quality of Dendrobium nobile Lindley is precisely identified and controlled.

Description

Technical field [0001] The invention belongs to the field of detection and analysis of traditional Chinese medicine components, and specifically relates to a quality detection method of Dendrobium nobile. Background technique [0002] Dendrobium nobile Lindley: The stem is upright, fleshy and thick, slightly flattened cylindrical, 10cm to 40cm long, and up to 1.3cm in diameter. The upper part is somewhat folded back, the base is obviously narrow, not branched, and knotty. , The nodes are sometimes slightly swollen; the internodes are somewhat inverted conical, 2cm to 4cm long, golden yellow after drying. The leaf base is sheathed with stalk. Racemes often emerge from the middle of old stems with leaves or deciduous leaves, 2cm~4cm long, with 1~4 flowers; inflorescence stalk length 0.5cm~1.5cm, base with several tubular sheaths; flower bracts membranous , Ovate-lanceolate, length 0.6cm~1.3cm, apex acuminate; pedicel and ovary lavender, length 0.3cm~0.6cm; flower large, white wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N30/02G01N30/06
CPCG01N30/02G01N30/06
Inventor 赵田刘仲健
Owner 北京蓝标一成科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com