Quality detection method of Dendrobium nobile Lindley
A quality inspection method and technology of Dendrobium candidum, applied in measurement devices, instruments, scientific instruments, etc., can solve problems such as the inability to fully reflect the overall curative effect, achieve strong interpretation pertinence and applicability, effectively identify and control quality, and solve problems. Effects of the curse of dimensionality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 First-generation sequencing of Dendrobium nobile
[0053] First generation sequencing primer sequence:
[0054] ITS-26SE: 5’GAATTCCCCGGTTCGCTCGCCGTTAC 3’;
[0055] ITS-17SE: 5’ACGAATTCATGGTCCGGTGAAGTGTTCG 3’.
[0056] The amplification and sequencing parameters are: PCR cycle after denaturation at 98°C for 2min. PCR cycle parameters are 98°C for 20s; 52°C for 30s; 68°C for 1min, 38 cycles, 68°C for 7min. After amplification, set 4°C to keep warm and proceed. First-generation molecular sequencing.
[0057] Through the first generation sequencing, the species of Dendrobium nobile to be tested was identified as Dendrobium nobile.
Embodiment 2
[0058] Example 2 Extraction method of Dendrobium nobile
[0059] Take a dried sample of Dendrobium nobile, crush it with a grinder, pass through a pharmacopoeia sieve (aperture 0.335mm), accurately weigh 1.000g of Dendrobium powder (weighing error cannot exceed 0.2%), place it in a 100ml conical flask, and add 50mL 75 % Methanol (V water:V methanol=25:75), ultrasonic for 30min at room temperature, take it out, filter, the filtrate is concentrated to dryness by rotary evaporation, dissolved in 75% methanol solvent (V water:V methanol=25:75), and finally transferred Place the volume in a 10ml volumetric flask, shake well, and filter with a 0.45μm microporous membrane to obtain a sample solution of Dendrobium nobile.
Embodiment 3
[0060] Example 3 Chromatographic detection method of Dendrobium nobile extract
[0061] ① Preparation of reference solution
[0062] Weigh 4.10mg of Schafertoside and 4.08mg of Naringenin respectively, put them in a 10ml volumetric flask, add 75% (V / V) methanol to dissolve and dilute, shake well, and use as stock solution. Refrigerate in a refrigerator at 4℃ for later use.
[0063] Then accurately draw a certain amount of reference substance stock solution, dilute with 75% methanol, and accurately prepare the mixed reference substance solution of Schafertoside and naringenin. Seven concentration points are prepared by diluting the ingredients through different dilution ratios. Inject into the high performance liquid chromatograph.
[0064] ②Determination of the content of small molecules in Dendrobium nobile. Sample extraction and processing methods:
[0065] Take 1.00g of this product powder (pass the No. 3 sieve), accurately weigh it, place it in a 100ml volumetric flask, add 50ml ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap