Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus and application

A reovirus and fluorescence quantitative technology is applied in the field of avian virus detection, which can solve the problems that the new duck reovirus cannot be detected, the new duck reovirus has not been detected, and cannot be quantified, and achieves high sensitivity, Loss-reducing, specific effects

Inactive Publication Date: 2018-10-02
SHANDONG AGRICULTURAL UNIVERSITY
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular biology diagnostic technology mainly includes traditional polymerase chain reaction (PCR) method and fluorescent PCR method, and traditional PCR method can only be qualitative to virus infection, can not quantify, and sensitivity is also low; Fluorescent quantitative PCR technology is with its high sensitivity, The advantages of fast speed and strong specificity have been widely used in gene expression level analysis, qualitative and quantitative detection of pathogens, etc.
There have been reports on the detection of reovirus in cattle by fluorescent quantitative PCR method, but because the new duck reovirus strain was reported for the first time, the diagnostic strategy of reovirus for mammals and other birds cannot be used for this new type of duck reovirus. Detection of duck reovirus, so far there is no effective method for detecting this new type of duck reovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus and application
  • Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1: the design of fluorescence quantitative PCR primer and probe

[0057] According to the second-generation sequencing technology, the whole genome sequence of the new duck reovirus (preservation number is CCTCC NO: V201818) was obtained. In the whole genome sequence, L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 are The sequences of the 10 gene fragments are respectively shown in SEQ ID NO.4-SEQ ID NO.13.

[0058] Design specific primer sequences and fluorescent probe sequences for the sequence conserved region of the M1 gene, the sequence design is as follows:

[0059] Forward primer: M1-F: ATTATCCATTTTGAGATCCACG; (SEQ ID NO.1)

[0060] Reverse primer: M1-R; TTGGTTGCTTTCCTAGCGCTT; (SEQ ID NO.2)

[0061] Fluorescent probe: 5'-FAM-TGCGAGTCGGTTCTAGTCGCA-TMARA-3'; (SEQ ID NO.3)

[0062] The 5' end of the fluorescent probe is labeled with a fluorescent reporter group FAM, the 3' end is labeled with a fluorescent quencher group TMARA, and the length of the amplified ...

Embodiment 2

[0063] Example 2: Establishment of Fluorescent Quantitative PCR Detection Method

[0064] (1) Extraction of viral RNA:

[0065] Extract the total RNA of the sample to be tested using the classic Trizol method or a commercial kit;

[0066] (2) Establishment of fluorescent PCR reaction system:

[0067] The one-step fluorescence quantification kit used adopts the One StepPrimerScript from Takara Company whose article number is RR064A TM RT-PCR Kit kit, add 2×One Step RT-PCR BufferⅢ~10μl, 1×TaKaRa Ex Taq HS(5U / μl)~0.4μl, PrimeScript RT EnzymeMixⅡ~0.4μl, PCR Forward Primer (10μM) ~ 0.4μl, PCR Reverse Primer (10μM) ~ 0.4μl, Probe ~ 0.8μl, ROX Reference Dye or DyeⅡ (50×) ~ 0.4μl, Total RNA of the sample to be tested extracted in step (1) ~ 2 μl, using RNase Free dH 2 O supplemented to 20μl system. Placed in ABI 7300Fast fluorescent quantitative PCR instrument for reaction, the reaction conditions were 42°C for 5min; 95°C for 10s; then 95°C for 5s and 60°C for 34s for 40 cycles. ...

Embodiment 3

[0075] Example 3: The composition of the kit, the optimization of experimental parameters and the investigation of specificity, sensitivity and repeatability

[0076] 1. The composition of the kit:

[0077] The kit in this example is a fluorescent quantitative PCR kit, which is used to detect a new type of duck reovirus (preservation number is CCTCC NO: V201818). The kit contains: the forward primer (10 μM) shown in SEQ ID NO.1 designed in Example 1, the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1, and the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1 The probe shown in SEQ ID NO.1, a standard and a fluorescent quantitative PCR reaction reagent.

[0078] Standards were prepared as follows:

[0079] The primers shown in SEQ ID NO.1-SEQ ID NO.2 were used to amplify the genome of the duck reovirus whose preservation number is CCTCC NO: V201818, and an 80bp amplification product (shown in SEQ ID NO.14) was obtained. The amplified produc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus and application. The fluorescent quantitative PCR kit comprises primers of SEQID NO.1-SEQ ID NO.2 as shown in the specification and a probe of SEQ ID NO.3 as shown in the specification, a standard product and a fluorescent quantitative PCR reaction reagent. The fluorescent quantitative PCR kit disclosed by the invention is capable of detecting the novel duck reovirus, is good in specificity, is only specifically combined with the novel duck reovirus and has no cross reaction with other duck viruses; in addition, the kit is high in detection sensitivity, has a good linear relationship when a standard product is within a copy range of 4*10<1>-4*10<9>, has a detection range up to 9 orders of magnitudes, is capable of efficiently detecting tissue of sick ducks with the novel duck reovirus and virus carrying ducks without clinical symptoms, and is capable of improving detection efficiency.

Description

technical field [0001] The invention relates to the technical field of poultry virus detection, in particular to a fluorescent quantitative PCR kit for detecting novel duck reovirus and its application. Background technique [0002] Avian reovirus belongs to the genus Orthoreovirus of the Reovirdae family and can cause a variety of diseases in poultry. Its clinical manifestations vary depending on the virus strain, virulence or infected host. . [0003] Since 2016, there has been a large-scale outbreak of infectious diseases in ground ducks in Shandong, Hebei, Henan and Jiangsu, with swelling of the tarsal joint as the main symptom. The disease mainly causes swelling of the tarsal joint of ducks of all ages, and the tarsal joint often contains a small amount of yellow Blood sample exudate, in severe cases, there is caseous exudate in the joint cavity, and the affected ducks have different degrees of lameness. The disease mainly leads to a decrease in egg production and wei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2563/107
Inventor 唐熠刁有祥王鸿志
Owner SHANDONG AGRICULTURAL UNIVERSITY