Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus causing duck spleen necrosis
A fluorescent quantitative and detection reagent technology, applied in the field of poultry virus detection, can solve the problems of no effective method for detection of new duck reovirus, inability to quantify, low sensitivity, etc., and achieve high sensitivity, loss reduction, and strong specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0058] Example 1: Design of fluorescent quantitative PCR primers and probes
[0059] The whole genome sequence of the novel duck reovirus (deposit number CCTCC NO: V201843) was obtained according to the next-generation sequencing technology. The whole genome sequence L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 The sequences of the 10 gene fragments are shown in SEQ ID NO.4-SEQ ID NO.13, respectively.
[0060] Design specific primer sequences and fluorescent probe sequences for the sequence conserved region of the M1 gene, and the sequence design is as follows:
[0061] Forward primer: M1-F: ATTAGCTCTAGCCACAGCCCTG; (SEQ ID NO. 1)
[0062] Reverse primer: M1-R: CAATAGTGCATAGCATCAAGTAC; (SEQ ID NO. 2)
[0063] Fluorescent probe: 5'-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3'; (SEQ ID NO.3)
[0064] The 5' end of the fluorescent probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quenching group TMARA, and the amplified fragment length is 83 b...
Embodiment 2
[0066] Example 2: Establishment of Fluorescence Quantitative PCR Detection Method
[0067] (1) Extraction of viral RNA:
[0068] Extract the total RNA of the sample to be tested by the classic Trizol method or commercial kit;
[0069] (2) Establishment of fluorescent PCR reaction system:
[0070] The one-step fluorescence quantitative kit used was the GoldStarTaqman One Step RT-qPCR Ki kit with the product number CW2633S from Kangwei Century Company. In a 200 μl fluorescence PCR reaction tube, 2 × GoldStarTaqMan One Step Buffer ~ 12.5 μl, Forward Primer ( 10μM)~0.5μl, Reverse Primer (10μM)~0.5μl, Probe (10μM)~0.5μl, GoldStar TaqMan One Step EnzymeMix~1.0μl, 50×Low ROX or High ROX(optional)~0.5μl, step (2) Total RNA ~ 2μl of the sample to be tested extracted from RNase Free dH 2 O supplemented to 25 μl system. The reaction was carried out in an ABI 7300Fast fluorescence quantitative PCR instrument. The reaction conditions were 45 °C for 10 min; 95 °C for 10 min, 95 °C for 1...
Embodiment 3
[0078] Example 3: Composition of the kit, optimization of experimental parameters and investigation of specificity, sensitivity and repeatability
[0079] 1. The composition of the kit:
[0080]The kit in this example is a fluorescence quantitative PCR kit, which is used to detect a novel duck reovirus (the deposit number is CCTCC NO: V201843). The kit contains: the forward primer (10 μM) shown in SEQ ID NO.1 designed in Example 1, the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1, and the reverse primer (10 μM) designed in Example 1 Probe, standard substance and fluorescent quantitative PCR reaction reagent shown in SEQ ID NO.1.
[0081] Standards are prepared as follows:
[0082] The primers shown in SEQ ID NO.1-SEQ ID NO.2 were used to amplify the genome of duck reovirus whose deposit number was CCTCC NO: V201843 to obtain an amplification product of 83bp (shown in SEQ ID NO.14), The amplified product was connected to the pMD18-T vector, positive clon...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com