Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus causing duck spleen necrosis

A fluorescent quantitative and detection reagent technology, applied in the field of poultry virus detection, can solve the problems of no effective method for detection of new duck reovirus, inability to quantify, low sensitivity, etc., and achieve high sensitivity, loss reduction, and strong specificity Effect

Inactive Publication Date: 2018-12-11
SHANDONG AGRICULTURAL UNIVERSITY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular biology diagnostic technology mainly includes traditional polymerase chain reaction (PCR) method and fluorescent PCR method, and traditional PCR method can only be qualitative to virus infection, can not quantify, and sensitivity is also low; Fluorescent quantitative PCR technology is with its high sensitivity, The advantages of fast speed and strong specificity have been widely used in gene expression level analysis, qualitative and quantitative detection of pathogens, etc.
However, due to the first report of the new duck reovirus strain, there is still no effective method for detecting the new duck reovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Design of fluorescent quantitative PCR primers and probes

[0059] The whole genome sequence of the novel duck reovirus (deposit number CCTCC NO: V201843) was obtained according to the next-generation sequencing technology. The whole genome sequence L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 The sequences of the 10 gene fragments are shown in SEQ ID NO.4-SEQ ID NO.13, respectively.

[0060] Design specific primer sequences and fluorescent probe sequences for the sequence conserved region of the M1 gene, and the sequence design is as follows:

[0061] Forward primer: M1-F: ATTAGCTCTAGCCACAGCCCTG; (SEQ ID NO. 1)

[0062] Reverse primer: M1-R: CAATAGTGCATAGCATCAAGTAC; (SEQ ID NO. 2)

[0063] Fluorescent probe: 5'-FAM-TGCGAGTAGTCGGTTCTCGCA-TMARA-3'; (SEQ ID NO.3)

[0064] The 5' end of the fluorescent probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quenching group TMARA, and the amplified fragment length is 83 b...

Embodiment 2

[0066] Example 2: Establishment of Fluorescence Quantitative PCR Detection Method

[0067] (1) Extraction of viral RNA:

[0068] Extract the total RNA of the sample to be tested by the classic Trizol method or commercial kit;

[0069] (2) Establishment of fluorescent PCR reaction system:

[0070] The one-step fluorescence quantitative kit used was the GoldStarTaqman One Step RT-qPCR Ki kit with the product number CW2633S from Kangwei Century Company. In a 200 μl fluorescence PCR reaction tube, 2 × GoldStarTaqMan One Step Buffer ~ 12.5 μl, Forward Primer ( 10μM)~0.5μl, Reverse Primer (10μM)~0.5μl, Probe (10μM)~0.5μl, GoldStar TaqMan One Step EnzymeMix~1.0μl, 50×Low ROX or High ROX(optional)~0.5μl, step (2) Total RNA ~ 2μl of the sample to be tested extracted from RNase Free dH 2 O supplemented to 25 μl system. The reaction was carried out in an ABI 7300Fast fluorescence quantitative PCR instrument. The reaction conditions were 45 °C for 10 min; 95 °C for 10 min, 95 °C for 1...

Embodiment 3

[0078] Example 3: Composition of the kit, optimization of experimental parameters and investigation of specificity, sensitivity and repeatability

[0079] 1. The composition of the kit:

[0080]The kit in this example is a fluorescence quantitative PCR kit, which is used to detect a novel duck reovirus (the deposit number is CCTCC NO: V201843). The kit contains: the forward primer (10 μM) shown in SEQ ID NO.1 designed in Example 1, the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1, and the reverse primer (10 μM) designed in Example 1 Probe, standard substance and fluorescent quantitative PCR reaction reagent shown in SEQ ID NO.1.

[0081] Standards are prepared as follows:

[0082] The primers shown in SEQ ID NO.1-SEQ ID NO.2 were used to amplify the genome of duck reovirus whose deposit number was CCTCC NO: V201843 to obtain an amplification product of 83bp (shown in SEQ ID NO.14), The amplified product was connected to the pMD18-T vector, positive clon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus causing duck spleen necrosis. The fluorescent quantitative PCR kit contains primers shown as SEQ ID NO. 1 to SEQ ID NO. 2, a probe shown as SEQ ID NO. 3, a standard substance and a fluorescent quantitative PCR reaction reagent. The fluorescent quantitative PCR kit disclosed by the invention can be used for detecting the novel duck reovirus; the kit has high specificity, is only specifically combined with the novel duck reovirus and has no crossed reaction with other duck-derived viruses; the fluorescent quantitative PCR kit has high detection sensitivity and has an extremely good linear relation with the standard substance within a copying range of 4*10<1> to 4*10<9>; adetection range can reach 9 orders of magnitude; the fluorescent quantitative PCR kit can be used for efficiently detecting diseased duck tissues of the novel duck reovirus and virus-carrying ducks without clinical symptoms, and the detection efficiency is improved.

Description

technical field [0001] The invention relates to the technical field of avian virus detection, in particular to a fluorescent quantitative PCR kit for detecting a novel duck reovirus that causes duck spleen necrosis. Background technique [0002] Avian reovirus belongs to the genus Orthoreovirus of the family Reovirdae and can cause a variety of diseases in birds, and its clinical manifestations vary with virus strains, virulence or infecting hosts. . [0003] Since 2017, a large-scale outbreak of infectious diseases with spleen necrosis as the main symptom has occurred in ducks in Shandong, Hebei, Henan, Jiangsu, Anhui and other places in my country. Egg-laying and meat ducks have loss of appetite, weight loss, poor growth and development, and there are several necrotic foci of different degrees in the spleen, swelling, hemorrhage, and marginal hyperplasia. The increase of duck feed-to-meat ratio will significantly reduce the qualified rate of meat ducks for slaughtering, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2561/101C12Q2545/114
Inventor 唐熠刁有祥杨晶
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com