Lentiviral vector of mucopolysaccharidosis, lentivirus, and preparation method and application of lentiviral vector

A lentiviral vector and mucopolysaccharide storage technology, which is applied in the field of lentiviral vector optimized expression of MPSII gene for the preparation of medicines for the treatment of Gaucher disease, and can solve the problem that the clinical effect of disease treatment cannot meet expectations, the difference in gene transfer efficiency, and the impact of Disease treatment effect and other issues, to achieve the effect of strong stability, good safety, and improved safety performance

Inactive Publication Date: 2018-11-13
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, although there are many gene therapy methods using viral vectors for gene delivery at home and abroad, the gene delivery efficiency caused by different viral vectors or even different preparation methods of the same vector is significantly different, and the gene delivery efficiency will directly affect the therapeutic effect of the disease
At present, most of the methods of applying gene therapy to treat genetic diseases are too inefficient and only modify blood stem cells, so that the clinical effect of disease treatment has always failed to meet expectations. Therefore, there is an urgent need for methods that can maximize the efficiency of viral gene delivery To improve the treatment of genetic diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector of mucopolysaccharidosis, lentivirus, and preparation method and application of lentiviral vector
  • Lentiviral vector of mucopolysaccharidosis, lentivirus, and preparation method and application of lentiviral vector
  • Lentiviral vector of mucopolysaccharidosis, lentivirus, and preparation method and application of lentiviral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The construction of embodiment 1 lentiviral vector

[0068] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0069] (1) Schematic diagram of the transformation of the lentiviral vector pTYF as shown in figure 1 As shown, the specific mutation is to mutate the wild-type 5' splice donor site GT to CA, and delete the enhancer in U3. The specific transformation method can be found in "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI, JOURNAL OF VIROLOGY, July 1999, p.6171–6176”, as follows:

[0070] Modification of the 5' splice donor site:

[0071] Wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0072] Mutant (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0073] (2) Insertion of promoter and MPS II gene:

[0074] Synthesize the normal MPS II gene sequence (as shown in SE...

Embodiment 2

[0079] Preparation and identification of embodiment 2 lentivirus

[0080] 1) Preparation of lentivirus

[0081] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0082] (1) The lentiviral vector constructed in Example 1 and the packaging helper plasmid pNHP and pHEF-VSV-G were co-transfected into mammalian cells HEK293T and cultured for 24-72h;

[0083] (2) Purifying and concentrating the cultured lentivirus to obtain the lentivirus.

[0084] 2) Identification of lentivirus

[0085] The collected neuron cells and glial cells transfected with normal MPS II gene lentivirus were identified for protein expression to clarify the expression of MPS II gene in neuron cells.

[0086] From the results, there was no expression of idose-2-sulfatase protein in the negative control cells of neuron cells without lentivirus transfe...

Embodiment 3

[0088] The therapeutic effect of embodiment 3 lentivirus

[0089] The lentivirus carrying the normal MPS II gene prepared in Example 2 is directly injected into the brain to treat mucopolysaccharidosis disease, and the schematic diagram of the treatment process is as follows: Figure 4 As shown, the injection site of the lentiviral vector and the specific coordinates of the brain are determined by MRI or CT of the brain, and the lentiviral vector carrying the normal MPS II gene is injected directly into the brain of the patient to treat the disease. treat.

[0090] It can be seen from the results that direct injection of lentivirus can effectively improve the transfer efficiency and expression level of MPS II gene in the brain.

[0091] In summary, the lentiviral vector of this application can directly repair the damaged MPS II gene in cells, and can effectively improve the transfer efficiency and expression level of MPS II gene in the brain, which is very important for ensur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lentiviral vector of mucopolysaccharidosis, a lentivirus, and a preparation method and application of the lentiviral vector. The lentiviral vector is prepared by modifying a splicing donor site at the 5' end of a pTYF lentiviral vector, and also includes an MPS II gene. On the basis of the modified lentiviral vector, the MPS II gene is specifically linked in, thereby achieving more efficient gene delivery while ensuring safety, significantly increasing the expression quantity of the MPS II gene in transgenic brain-related cells, and more efficiently completing the transmission of normal genes during the gene therapy of mucopolysaccharidosis.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a lentiviral vector for mucopolysaccharidosis, a lentivirus and its preparation method and application, in particular to an optimized expression of the MPS II gene by using the improved lentiviral vector for the preparation of therapeutic drugs Drugs to thank for illness. Background technique [0002] Mucopolysaccharidosis type II, also known as Hunter syndrome, was first described by Hunter (1917). Mekusick (1965) classified it as mucopolysaccharidosis type Ⅱ, which belongs to sex-linked recessive inheritance and is caused by mutations in the iduornate-2-sulphate sulphatase (IDS) gene. Affected patients were all males, and the patient's mother was a carrier but did not develop the disease. This type can be divided into two subtypes: MPSⅡ-A is severe, with severe mental insufficiency, and most of them die before the age of 15; MPSⅡ-B is light, with normal intelligence...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N7/01A61K48/00A61K38/46A61P43/00
CPCA61K38/465A61K48/0008A61K48/005A61P43/00C12N7/00C12N15/86C12N2740/15021C12N2740/15043C12N2740/15052C12N2800/107C12Y301/06013A61K48/0075C07K14/4705C12N9/16C12N2740/16043
Inventor刘崇灵
OwnerSHENZHEN GENO IMMUNE MEDICAL INST