Unlock instant, AI-driven research and patent intelligence for your innovation.

Peptides and their preparation and use

A host cell and sequence technology, applied in the field of genetic engineering, can solve the problems of limited chemical synthesis, limited wide use, high cost and other problems of the preparation method, and achieve the effects of broad market application prospect, low production cost and low cost.

Active Publication Date: 2019-06-21
SHANXI JINBO BIO PHARMA CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sequence of melanostatine-5 contains two D-type amino acids, which is not easy to be prepared by biological fermentation. Therefore, its preparation method is still limited to chemical synthesis, and its high cost limits the wide application of this type of product. use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peptides and their preparation and use
  • Peptides and their preparation and use
  • Peptides and their preparation and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Construction and expression of pET-32a-M11-2 gene expression vector

[0071] (1) Construction of Escherichia coli Genetic Engineering Bacteria

[0072] 1.1. Since the expression efficiency of the polypeptide can be significantly improved by expressing the M11 polypeptide gene in tandem, this embodiment selects n=2, that is, M11-2 with 2 repeats, and its amino acid sequence is GMPFRWFKPVNGMPFRWFKPVN (SEQ ID No.2).

[0073] 1.2. According to the amino acid sequence of M11-2, the preferred codon gene of Escherichia coli was optimized and selected, that is, ggcatgccgtttcgctggttcaaaccggtgaacggcatgccgtttcgctggtttaaaccggtgaac (SEQ ID No. 6). In order to meet the requirements of subsequent polypeptide digestion, the 5' end of this gene was added with AAT (hydroxyaminase cutting site), and TAA (stop codon) is added to the 3' end, and the complete gene is aat ggcatgccgtttcgctggttcaaaccggtgaacggcatgccgtttcgctggtttaaaccggtgaac taa (SEQ ID No.7) (synthesized by GENEWI...

Embodiment 2

[0085] Example 2: Human Trial of Whitening Short Peptide M11

[0086] The whitening short peptide M11 was sterilized by filtration with a 0.22 μm membrane, diluted with purified water to 40 μg / mL, and stored in the refrigerator for later use.

[0087] 40 volunteers (20 males, 20 females, aged 23-45 years old) were randomly divided into two groups, A and B, 20 in each group (10 males, 10 females), the left face of volunteers in group A was tested 7ml of 40μg / mL whitening short peptide M11, 7ml of pure water was used on the left face of volunteers in group B, and the right face was used as a blank control group. During the experiment period, other whitening cosmetics were stopped, and the melanin content was measured after continuous use for 7 days.

[0088] Method reference: "Cui Huanlian, Cao Rui, Yin Jiazhen, etc. Efficacy Evaluation of Whitening Cosmetics [J]. Fragrance and Fragrance Cosmetics, 2012, 4(2):37-40" (which is incorporated herein by reference), by MX 18 skin p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to peptides, methods for their preparation and uses. A peptide comprising the sequence shown in SEQ ID No. 1 or a sequence in which one or several amino acids are substituted, deleted, inserted and / or added to the sequence shown in SEQ ID No. 1, said peptide showing inhibition of melanoblasts or Melanin-producing activity or whitening activity. The present invention also provides peptide-encoding nucleotide sequences, vectors containing the nucleotide sequences, and hosts containing the vectors. The peptide of the present invention has an amino acid sequence similar to MSH-α, can be prepared on a large scale through biological fermentation, and can be used in the whitening cosmetics industry.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a peptide and its preparation method and use. [0002] Background technique: [0003] Skin whitening is the persistent pursuit of many Asian women, and there is a traditional saying that "one white covers all ugliness". From a scientific point of view, the color of the skin is mainly determined by the pigment content in the skin, the most important being the content of melanin. The amount of melanin in the skin can largely determine the depth of the skin color. Melanin is a protein that exists in every human skin, hair, retina, pia mater and other tissues. The granules of melanin are not all pure black, but also have yellowish brown, reddish brown, tan, dark brown and so on. Working together, they determine the different colors of human skin and hair. [0004] Melanin is produced by the secretion of melanoblasts. Melanoblasts are glandular cells with strong secretor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K7/06C12N15/11A61K8/64A61Q19/02
CPCA61K8/64A61Q19/02C07K7/06
Inventor 杨霞
Owner SHANXI JINBO BIO PHARMA CO LTD