Kits and methods for detecting CMV infection in ocular trace biological samples

A kit and ocular technology, applied in the field of detection of CMV infection in trace biological samples of the eye, can solve the problems of lack of highly sensitive detection methods for ocular tissue virus infection, unseen, and inability to accurately reflect the real cause of the eye

Active Publication Date: 2019-11-26
PEKING UNIV THIRD HOSPITAL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Another example is the high incidence of CMV infection in patients with tumor transplantation. At present, the clinical focus is only on blood testing and systemic administration. Due to the lack of intraocular detection methods, intraocular CMV infection is often overlooked, and secondary CMV intraocular infection occurs. Cases leading to vision loss are also increasing
[0005] At present, blood tests are still used to detect ocular viral infections, but a large number of clinical data studies have found that blood tests cannot accurately reflect the real cause of the eye, especially the cause of infectious eye diseases, which is easy to miss and misdiagnose
[0006] Obtaining accurate detection results of eye infection is the prerequisite for correct treatment in the subsequent sequence; however, there is still a lack of highly sensitive detection methods specifically for virus infection in ocular tissues, and there is no use of micro-samples of the eye as specimens. Reports of High Sensitivity Detection of Viral Infections by PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kits and methods for detecting CMV infection in ocular trace biological samples
  • Kits and methods for detecting CMV infection in ocular trace biological samples
  • Kits and methods for detecting CMV infection in ocular trace biological samples

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0118] Example 1. Method for extracting DNA from test specimens of eye microfluidics

[0119] Material:

[0120] Specimens to be tested: collected from admitted patients, tear fluid, aqueous humor 2, and vitreous.

[0121] (1) Put the collected sample to be tested into a container, add 10-30 μl proteinase K, 100-300 μl lysis buffer AL, and treat at 56°C for more than 10 minutes;

[0122] (2) Add the same volume of absolute ethanol as the lysis buffer, shake and mix for 10-20s, and centrifuge briefly;

[0123] (3) Put the liquid obtained in step (2) into a spin column, put it into a 2ml collection tube, and centrifuge at 6000-9000rpm for 0.5-2min;

[0124] If the sample volume > 140 μl, repeat step (3);

[0125] (4) Add 300-600μl elution buffer 1, 6000-9000rpm, 0.5-2min, discard the filtrate and collection tube, and replace with a new collection tube;

[0126] (5) Add 300-600μl Elution Buffer 2, centrifuge at 10000-15000rpm for 1-5min, discard the filtrate and collection tu...

Embodiment 2

[0135] Example 2. Method for extracting DNA from eye trace solid specimens to be tested

[0136] Material:

[0137] Specimens to be tested: collected from admitted patients, including retina, corneal endothelium, pterygium, conjunctiva, iris, and eye tumors, with a collection volume of 1×1mm;

[0138] step:

[0139] (1) Put the collected sample to be tested into a container, add 10-30 μl proteinase K, 100-300 μl lysis buffer AL, and treat at 56°C for 6-12 hours;

[0140] (2) Add the same volume of absolute ethanol as the lysis buffer, shake and mix for 10-20s, and centrifuge briefly;

[0141] (3) Put the liquid obtained in step (2) into a spin column, put it into a 2ml collection tube, and centrifuge at 6000-9000rpm for 0.5-2min;

[0142] (4) Add 300-600μl elution buffer 1, 6000-9000rpm, 0.5-2min, discard the filtrate and collection tube, and replace with a new collection tube;

[0143] (5) Add 300-600μl Elution Buffer 2, centrifuge at 10000-15000rpm for 1-5min, discard th...

Embodiment 3

[0151] Example 3. Kit for detection of ocular CMV infection by ocular microsamples

[0152] DNA extraction reagent set:

[0153] Lysis buffer: Tris-saturated phenol with 10% SDS,

[0154] Elution buffer 1: a mixture of saturated phenol: chloroform: isoamyl alcohol with a volume ratio of 25:24:1;

[0155] Elution buffer 2: absolute ethanol,

[0156] Elution buffer 3: pH 8.0, 10 mmol / L Tris-HCl solution containing 1 mmol / LEDTA.

[0157] Specific primers and probes for PCR amplification

[0158] Primer-F: TCGTGAAACACGCTCGCTTT

[0159] Primer-R: TGGTCGGTACACGGTCCCTT

[0160] Probe: GACCCGGTGTTCCTTGGAGA

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit and a method for detecting CMV infection in a trace biological sample of an eye, and relates to a molecular detection technology for eye viral infections, in particularto a method for extracting DNA from the trace biological sample, wherein the trace biological sample refers to a liquid sample with a volume not exceeding 10mu l-200mu l or a solid sample with a volume not exceeding 1mm<3>. By use of the extracted DNA as a PCR detection template, the eye viral infections can be detected with an accuracy of 80% or more, and the method provides a reliable basis forsubsequent appropriate treatment methods and reduces the blindness of the treatment methods.

Description

technical field [0001] The invention relates to a molecular detection technology of virus infection, in particular to a kit and a method for detecting CMV infection in eye trace biological samples. [0002] technical background [0003] Due to the complex structure of the eye and the influence of the blood-brain barrier, the correlation between many detection indicators of eye tissue samples and blood detection indicators is very low. A large number of clinical data studies have found that blood tests cannot accurately reflect the true cause of the eye, especially The etiology of infectious eye diseases; on the other hand, eye specimens are small in size and have a variety of specimen types, including various tissues, various body fluids (vitreous, aqueous humor, tears, etc.), various membranes (retina, corneal endothelium, etc.) ), multi-site secretions, etc., the viral DNA content in ocular liquid samples is extremely low, while the viral DNA in solid samples is difficult t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/6806C12Q1/6851C12N15/11
CPCC12Q1/6806C12Q1/6851C12Q1/705C12Q2527/125C12Q2531/113C12Q2545/113
Inventor张培冯丽娜黄琛王薇
OwnerPEKING UNIV THIRD HOSPITAL