Unlock instant, AI-driven research and patent intelligence for your innovation.

Human HLA-F monoclonal antibody as well as preparation method and application thereof

An HLA-F, monoclonal antibody technology, applied in the field of human HLA-F monoclonal antibody and its preparation, can solve the problems of inability to neutralize the antibody, use, etc.

Inactive Publication Date: 2019-01-01
XUZHOU MEDICAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most HLA-F antibodies currently on the market are mainly used to detect western blots, and cannot be used as neutralizing antibodies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human HLA-F monoclonal antibody as well as preparation method and application thereof
  • Human HLA-F monoclonal antibody as well as preparation method and application thereof
  • Human HLA-F monoclonal antibody as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] This embodiment provides a preparation method of human HLA-F monoclonal antibody, comprising the following steps:

[0044] (1) Using the overlapping region amplification method, design full-length splicing primers, synthesize the gene HLA-F, and connect the synthetic gene HLA-F into the vector pCzn1(+) to obtain the recombinant plasmid pCzn1(+)-HLA-F;

[0045] Transfer the obtained recombinant plasmid pCzn1(+)-HLA-F into the TOP10 clone strain (a type of Escherichia coli TM), pick the positive clones for sequencing, and the splicing of the sequencing results is as follows, the single-lined region is the HLA-F gene area:

[0046] GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCAT CATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGA...

Embodiment 2

[0059] This embodiment provides a preparation method of human HLA-F monoclonal antibody, comprising the following steps:

[0060] (1) Using the overlapping region amplification method, design full-length splicing primers, synthesize the gene HLA-F, and connect the synthetic gene HLA-F into the vector pCzn1(+) to obtain the recombinant plasmid pCzn1(+)-HLA-F;

[0061] Transfer the obtained recombinant plasmid pCzn1(+)-HLA-F into the TOP10 clone strain (a type of Escherichia coli TM), pick the positive clones for sequencing, and the splicing of the sequencing results is as follows, the single-lined region is the HLA-F gene area:

[0062] GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCAT CATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGACC...

Embodiment 3

[0075] This embodiment provides a preparation method of human HLA-F monoclonal antibody, comprising the following steps:

[0076] (1) Using the overlapping region amplification method, design full-length splicing primers, synthesize the gene HLA-F, and connect the synthetic gene HLA-F into the vector pCzn1(+) to obtain the recombinant plasmid pCzn1(+)-HLA-F;

[0077] Transfer the obtained recombinant plasmid pCzn1(+)-HLA-F into the TOP10 clone strain (a type of Escherichia coli TM), pick the positive clones for sequencing, and the splicing of the sequencing results is as follows, the single-lined region is the HLA-F gene area:

[0078] GCACATTCCTTTAACGCTTCAAAATCTGTAAAGCACGCCATATCGCCGAAAGGCACACTTAATTATTAAGAGGTAATACACCATGAATCACAAAGTGCATCATCATCATCAT CATATGGGTAGTCATAGCCTGCGTTATTTTAG CACCGCCGTGAGTCGTCCGGGTCGCGGTGAACCGCGTTATATTGCAGTGGAATATGTTGATGATACCCAGTTTCTG CGTTTTGATAGTGATGCCGCCATTCCGCGTATGGAACCGCGCGAACCGTGGGTTGAACAGGAAGGCCCGCAGTATT GGGAATGGACCACCGGTTATGCAAAAGCAAATGCACAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a human HLA-F monoclonal antibody and a preparation method thereof. The preparation method comprises the following steps: linking a synthetic gene HLA-F to a vector pCzn1(+) to obtain recombinant plasmid; transferring the recombinant plasmid into an expression strain to obtain a monoclonal strain with ampicillin resistance; performing induced expression by IPTG (Isopropylbeta-D-Thiogalactoside) to obtain a target protein HLA-F inclusion body; performing denature and renaturation treatment and Ni column purification treatment in sequence to obtain a purified HLA-F protein; rapidly immunizing a mouse; fusing lymphocytes with myeloma cells of the immunized mouse; screening and subcloning positive pore cells to obtain a strong positive cell line; preparing ascitic fluid; purifying the ascitic fluid to obtain the human HLA-F monoclonal antibody. The human HLA-F monoclonal antibody is not only suitable for protein immunoblotting and ELISA (Enzyme-Linked Immuno Sorbent Assay), but also is suitable for immunoprecipitation, immunofluorescence and neutralizing antibodies. The human HLA-F monoclonal antibody can block the inhibitory effect of tumor cells on the immune function of NK cells, and activate the NK cells to target and kill tumor cells.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a human HLA-F monoclonal antibody and its preparation method and application. Background technique [0002] The change of human leukocyte antigen (human leukocyte antigen HLA) expression is one of the mechanisms for tumor cells to evade the body's immunity. HLA can assist tumor cells to evade the recognition and killing of cytotoxic T cells, and plays an important role in the occurrence and development of various malignant tumors. effect. Although the down-regulation of HLA-I molecule expression can help tumor cells escape the recognition and killing of cytotoxic T cells, it also enhances the killing activity of NK cells. However, studies have found that HLA-I-deficient tumor cells still have a strong growth advantage. Analysis confirmed that these cells overexpressed non-classical HLA-I molecules (HLA-E, F, G), which led to immune escape of tumor cells. HLA-F is the thir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28A61K39/395A61P35/00
CPCA61P35/00C07K16/2833C07K2317/76
Inventor 杨晶
Owner XUZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More