Supercharge Your Innovation With Domain-Expert AI Agents!

Chip, amplification reagent and kit for directly and simultaneously detecting alpha-thalassemia and beta-thalassemia mutation sites

A thalassemia and reagent technology, applied in the field of chips, amplification reagents and kits for direct and simultaneous detection of α and β thalassemia, can solve the problems of large specimen storage space, easy contamination, missed or false detection, etc., and achieve good results Effects of biological stability and safety, ease of storage and transportation

Inactive Publication Date: 2019-01-01
陈治中
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In addition, these techniques require DNA extraction, which is cumbersome and complicated, time-consuming, prone to cross-contamination, and experiments require DNA automatic extraction instruments, precision instruments and reagent consumables, which are expensive and cannot be widely used clinically.
The quality of DNA is a very critical factor for the success of PCR, and the process of extracting and purifying DNA is easily contaminated, making the experiment prone to false negatives or false positives, which can easily cause missed or false detections
[0009] In addition, these techniques require a large number of samples, and cold chain equipment is necessary for the transportation of samples collected in remote areas. A three-level packaging system is required, and the storage space for samples is large; the biosecurity risk factor is high
There is no patented technology for direct detection of thalassemia in whole blood, amniotic fluid and DBS, and there is no such product on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chip, amplification reagent and kit for directly and simultaneously detecting alpha-thalassemia and beta-thalassemia mutation sites
  • Chip, amplification reagent and kit for directly and simultaneously detecting alpha-thalassemia and beta-thalassemia mutation sites
  • Chip, amplification reagent and kit for directly and simultaneously detecting alpha-thalassemia and beta-thalassemia mutation sites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Embodiment 1: Using the kit specimen source and PCR template type of the present invention

[0091] 1.1 Sample collection and preparation of PCR template:

[0092] a) Sample collection: Specimens are derived from anticoagulated peripheral blood, DBS samples, embryonic villi, amniotic fluid, umbilical cord blood, peripheral blood, samples treated similar to DBS, saliva, genetic material of embryos including gametes such as sperm or eggs, cleavage stage Blastomeres of embryos, blastocyst trophectoderm cells, namely blastocyst cells, multiple cells or single cells, etc.;

[0093] b) Preparation of PCR template: the above-mentioned specimen is directly used as a template, or DNA extracted from the above-mentioned specimen by nucleic acid can also be used as a template.

[0094] 1.2 DBS sample preparation

[0095] The above 1.1 filter paper dry blood spot sample (DBS) collection and preparation are as follows:

[0096] ①. Use Whatman903 filter paper (or ordinary filter pa...

Embodiment 2

[0104] Example 2. Design of specific primers for PCR amplification and determination of PCR reaction system

[0105] 1.1 Primer design

[0106] The α-globin and β-globin gene sequences were obtained from the GenBank database, and a primer set was designed for PCR amplification according to the mutation regions covered by the α-globin and β-globin genes, and three pairs of primer combinations were placed at the same time. Perform direct multiplex PCR in one reaction tube to simultaneously amplify non-deletion mutations of α-thalassemia and β-thalassemia genes; another primer set is also placed in another reaction tube at the same time for direct multiplex PCR to amplify the deletion α-thalassemia gene Poor; primers were synthesized by a professional biological company. Primer sequences are shown in Table 1:

[0107] Table 1 Specific amplification of α-thalassemia gene and β-thalassemia gene primer set

[0108]

[0109] 1.2 Determination of multiplex PCR reaction system

...

Embodiment 3

[0119] Example 3: Design, spotting and immobilization of oligonucleotide probes

[0120]3.1. Design and screening of probes

[0121] The α-globin and β-globin gene sequences were obtained from the GenBank database, and the six mutations of α-thalassemia (QS, CS, WS, -- SEA , -α 3.7 with -α 4.2 ) and 19 oligonucleotide probe combinations for β-thalassemia gene mutations. Synthesized by a professional biological company. See Table 4 and Table 5 for specific oligonucleotide probes.

[0122] Table 4 detects α-thalassaemia 6 kinds of mutant oligonucleotide probe sets

[0123] serial number

sequence name

Sequence (5'to 3')

SEQ ID NO.26

WSN

GGAGGCGTGCACCGCA

SEQ ID NO.27

QSN

AACTTGTCCAGGGAGGCG

SEQ ID NO.28

CSN

CAAATACCGTTAAGCTGGAGCCT

SEQ ID NO.29

WSM

TGCGGTGCAGGCCTCC

SEQ ID NO.30

QSM

CGCCTCCCCGGACAAG

SEQ ID NO.31

CSM

CCAAATACCGTCAAGCTGGA

SEQ ID NO.32

SEA

CCAGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chip, an amplification reagent and a kit for directly and simultaneously detecting alpha-thalassemia and beta-thalassemia mutation sites, and belongs to a molecular diagnosis technology. According to the present invention, based on direct multiplex PCR, Gap-PCR and reverse dot blot combined detection principle, the corresponding amplification primers and the corresponding probes are designed according to the mutation or deletion sites of each genotype, the primer is labeled with biotin, the probe is labeled with amino, a gene chip is used as substrate, the probe is immobilized on the DNA chip, the PCR product amplified by the specific primer is hybridized with the probe, and the diagnosis of thalassemia is performed by interpreting a signal coloring box.

Description

technical field [0001] The invention relates to a molecular diagnosis technique for α and β thalassemia, in particular to a kit for simultaneously detecting 6 kinds of α thalassemia mutations and 19 kinds of point mutation β thalassemias in combination with direct PCR (DirectPCR) hybridization technology. Background technique [0002] Thalassemia (Thalassemia, referred to as thalassemia) is one of the most common genetic diseases in the world, which is caused by the reduction or absence of synthesis of one or more peptide chains of the globin chain composed of hemoglobin (Hb) tetramer. According to the adult major globin chain (α 2 beta 2 ), the disease is divided into α-thalassemia and β-thalassemia. Affected individuals mainly originate from the Mediterranean region, the Middle East, Transcaucasus, Central Asia, the Indian subcontinent, Southeast Asia, and East Asia. The incidence is high in places south of the Yangtze River in my country such as Guangdong, Guangxi, Hain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156C12Q2600/16C12Q2600/166
Inventor 陈治中卿吉琳
Owner 陈治中
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More