LRSAM1 gene SNP mutation site genotyping primer and application thereof in predication of coronary heart disease
A technology of mutation sites and typing primers, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of unverified correlation among Chinese populations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1, a susceptibility gene for coronary heart disease is the LRSAM1 gene. A test sample containing the gene of LRSAM1 can be obtained from the blood of the subject.
Embodiment 2
[0040] Embodiment 2, a reagent for in vitro detection of coronary heart disease-related genes, the reagent is used to detect the SNP genotype of the LRSAM1 gene rs3802358 site, the reagent includes the following primers and probes:
[0041] Upstream primer sequence 5'ATCCTGAAATGTAAGCAAATGACTGT3' (SEQ ID No.1);
[0042] Downstream primer sequence 5'GCCAGGATCCAGCCAGGTA3' (SEQ ID No.2);
[0043] G-type probe sequence 5'VIC-CCACACATACGGCTG-MGB3' (SEQ ID No.3);
[0044] Type A probe sequence 5'FAM-CCACACATATGGCTG-MGB3' (SEQ ID No.4).
[0045] The so-called SNP is single nucleotide polymorphism, which mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable variation in humans, accounting for more than 90% of all known polymorphisms. Some SNPs will directly affect the protein structure or gene expression level, and may themselves be candidate alteration sites for the genetic mechanis...
Embodiment 3
[0048] Embodiment 3, a preparation or kit with reagents for in vitro detection of coronary heart disease-related genes is characterized in that the kit includes PCR amplification enzyme (ie, DNA polymerase) and corresponding buffer. The kit for detecting coronary heart disease-related genes with rs3802358 polymorphism can be used for in vitro detection of coronary heart disease-related gene polymorphisms; the kit for coronary heart disease-related genes with mutations at rs3802358 can be used for detection, prevention, Diagnosis or treatment of coronary heart disease; the method for detecting coronary heart disease-related genes in vitro can be used for detection, prevention, diagnosis or treatment of coronary heart disease.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com