LRSAM1 gene SNP mutation site genotyping primer and application thereof in predication of coronary heart disease
A technology of mutation sites and typing primers, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of unverified correlation among Chinese populations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1, a susceptibility gene for coronary heart disease is the LRSAM1 gene. A test sample containing the gene of LRSAM1 can be obtained from the blood of the subject.
Embodiment 2
[0040] Embodiment 2, a reagent for in vitro detection of coronary heart disease-related genes, the reagent is used to detect the SNP genotype of the LRSAM1 gene rs3802358 site, the reagent includes the following primers and probes:
[0041] Upstream primer sequence 5'ATCCTGAAATGTAAGCAAATGACTGT3' (SEQ ID No.1);
[0042] Downstream primer sequence 5'GCCAGGATCCAGCCAGGTA3' (SEQ ID No.2);
[0043] G-type probe sequence 5'VIC-CCACACATACGGCTG-MGB3' (SEQ ID No.3);
[0044] Type A probe sequence 5'FAM-CCACACATATGGCTG-MGB3' (SEQ ID No.4).
[0045] The so-called SNP is single nucleotide polymorphism, which mainly refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is the most common type of heritable variation in humans, accounting for more than 90% of all known polymorphisms. Some SNPs will directly affect the protein structure or gene expression level, and may themselves be candidate alteration sites for the genetic mechanis...
Embodiment 3
[0048] Embodiment 3, a preparation or kit with reagents for in vitro detection of coronary heart disease-related genes is characterized in that the kit includes PCR amplification enzyme (ie, DNA polymerase) and corresponding buffer. The kit for detecting coronary heart disease-related genes with rs3802358 polymorphism can be used for in vitro detection of coronary heart disease-related gene polymorphisms; the kit for coronary heart disease-related genes with mutations at rs3802358 can be used for detection, prevention, Diagnosis or treatment of coronary heart disease; the method for detecting coronary heart disease-related genes in vitro can be used for detection, prevention, diagnosis or treatment of coronary heart disease.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


