Supercharge Your Innovation With Domain-Expert AI Agents!

Application of miR-495-5p in preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer

A technology for pancreatic cancer and pancreatic cancer cells, applied in the application field of the product, can solve the problem of unclear mode of action and related mechanisms

Active Publication Date: 2019-02-01
北京致成生物医学科技有限公司
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression, mode of action and related mechanism of miR-495 in pancreatic cancer are not clear and have not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-495-5p in preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer
  • Application of miR-495-5p in preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer
  • Application of miR-495-5p in preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: miR-495-5p is significantly abnormally expressed in pancreatic cancer cells

[0041] This example demonstrates that miR-495-5p is abnormally expressed in pancreatic cancer cells PANC-1 and BxPC-3 relative to normal pancreatic cells H6C7

[0042] 1. Extraction of total RNA from the sample

[0043] use Reagent (Invitrogen, Carlsbad, CA, USA) was used to extract RNA from normal pancreatic cell H6C7, pancreatic cancer cell PANC-1 and BxPC-3 samples, and the experimental operation was carried out according to the product manual. The specific operation was as follows:

[0044] Collect the samples and freeze them in liquid nitrogen. Take out about 30 mg of cell samples and place them in a pre-cooled mortar for grinding. After the cell samples are ground until no particles appear, follow the steps below:

[0045] ① Add Trizol and let stand at room temperature for 10 minutes;

[0046] ② Add 0.2 mL of chloroform, vibrate the centrifuge tube vigorously, mix well, a...

Embodiment 2

[0076] Example 2: Verification of the relationship between miR-495-5p and S100P target genes

[0077] This example proves that miR-495-5p can inhibit the expression of S100P.

[0078] 1. Design and synthesis of antisense oligonucleotides against miR-495-5p (anti-miR-495-5p)

[0079] According to the sequence information of miR-495-5p, the antisense oligonucleotide sequence and random control sequence of miR-495-5p were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd., and the antisense oligonucleotide of miR-495-5p ( miR-495-5p-inhibitor) sequence is shown in SEQ ID NO: 2 (CUUCAACGGGUACAAUAAAAGC).

[0080] 2. Transfection

[0081] The cationic liposome method was used for transient transfection, and the operation was performed according to Lipofectamine TM 2000 TransfectionReagent reagent instructions. Pancreatic cancer cells PANC-1 in good growth state were inoculated into 6-well plates 24 hours before transfection, and the cell count was about 5×10 4 ...

Embodiment 3

[0088] Example 3: Effects of inhibitors of miR-495-5p on the proliferation ability and cell cycle of pancreatic cancer cells PANC-1

[0089] Experimental groups: blank control group, negative control group, anti-miR-495-5p transfection experimental group.

[0090] Cells in the logarithmic growth phase were taken to form 1×10 4 / mL single cell suspension was inoculated in a 96-well plate, 100 μL per well, and 6 replicate wells were set up for each group. After the cells adhered to the wall, CCK-8 reagent was added, and the absorbance value at 450 nm wavelength was measured with a microplate reader after 2 hours as the zero point. After that, add 10 μL of CCK-8 reagent to each well and incubate for 2 hours every 24 hours for 5 consecutive days, measure the absorbance value of the cells with a microplate reader, and draw the cell proliferation curve. The result is as Figure 4 The results showed that compared with the control group, there was no significant difference in cell ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of miR-495-5p in the preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer. The invention also provides a diagnostic kitfor detecting the pancreatic cancer. The invention further provides a medicinal composition for prognosis, prevention or treatment of the pancreatic cancer. The medicinal composition comprises an miR-495-5p inhibitor or a mimetic / analog thereof as an active ingredient. It is found that the miR-495-5p has a strong specificity and a high sensitivity, can be effectively used for early detection of the pancreatic cancer, and can be used for gene therapy, drug therapy and other clinical applications.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of miR-495-5p in the preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer. Background technique [0002] Pancreatic cancer accounts for more than 95% of pancreatic malignant tumors, and its incidence rate is on the rise all over the world. The 5-year survival rate is only 1.2% to 6% due to the metastasis rate of 85% to 95%, and about 330,000 people die from the disease every year worldwide. people. Surgical resection is the most effective treatment for pancreatic cancer. However, due to postoperative distant metastasis and local recurrence, its 5-year survival rate is still lower than 20%, which brings a heavy burden to the family and society. Therefore, exploring the driver genes that can be used as therapeutic targets for pancreatic cancer is the focus and difficulty of current international research in related fields. [...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886A61K31/713A61P35/00
CPCA61K31/713A61P35/00C12Q1/6886C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 杨跃梅赵小灵贾冰寒
Owner 北京致成生物医学科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com