Application of miR-495-5p in preparation of products for diagnosis, prognosis, prevention or treatment of pancreatic cancer
A technology for pancreatic cancer and pancreatic cancer cells, applied in the application field of the product, can solve the problem of unclear mode of action and related mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: miR-495-5p is significantly abnormally expressed in pancreatic cancer cells
[0041] This example demonstrates that miR-495-5p is abnormally expressed in pancreatic cancer cells PANC-1 and BxPC-3 relative to normal pancreatic cells H6C7
[0042] 1. Extraction of total RNA from the sample
[0043] use Reagent (Invitrogen, Carlsbad, CA, USA) was used to extract RNA from normal pancreatic cell H6C7, pancreatic cancer cell PANC-1 and BxPC-3 samples, and the experimental operation was carried out according to the product manual. The specific operation was as follows:
[0044] Collect the samples and freeze them in liquid nitrogen. Take out about 30 mg of cell samples and place them in a pre-cooled mortar for grinding. After the cell samples are ground until no particles appear, follow the steps below:
[0045] ① Add Trizol and let stand at room temperature for 10 minutes;
[0046] ② Add 0.2 mL of chloroform, vibrate the centrifuge tube vigorously, mix well, a...
Embodiment 2
[0076] Example 2: Verification of the relationship between miR-495-5p and S100P target genes
[0077] This example proves that miR-495-5p can inhibit the expression of S100P.
[0078] 1. Design and synthesis of antisense oligonucleotides against miR-495-5p (anti-miR-495-5p)
[0079] According to the sequence information of miR-495-5p, the antisense oligonucleotide sequence and random control sequence of miR-495-5p were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd., and the antisense oligonucleotide of miR-495-5p ( miR-495-5p-inhibitor) sequence is shown in SEQ ID NO: 2 (CUUCAACGGGUACAAUAAAAGC).
[0080] 2. Transfection
[0081] The cationic liposome method was used for transient transfection, and the operation was performed according to Lipofectamine TM 2000 TransfectionReagent reagent instructions. Pancreatic cancer cells PANC-1 in good growth state were inoculated into 6-well plates 24 hours before transfection, and the cell count was about 5×10 4 ...
Embodiment 3
[0088] Example 3: Effects of inhibitors of miR-495-5p on the proliferation ability and cell cycle of pancreatic cancer cells PANC-1
[0089] Experimental groups: blank control group, negative control group, anti-miR-495-5p transfection experimental group.
[0090] Cells in the logarithmic growth phase were taken to form 1×10 4 / mL single cell suspension was inoculated in a 96-well plate, 100 μL per well, and 6 replicate wells were set up for each group. After the cells adhered to the wall, CCK-8 reagent was added, and the absorbance value at 450 nm wavelength was measured with a microplate reader after 2 hours as the zero point. After that, add 10 μL of CCK-8 reagent to each well and incubate for 2 hours every 24 hours for 5 consecutive days, measure the absorbance value of the cells with a microplate reader, and draw the cell proliferation curve. The result is as Figure 4 The results showed that compared with the control group, there was no significant difference in cell ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com