Fusion protein of thrombopoietin and preparation method and application thereof

A thrombopoietin and fusion protein technology, applied in the field of genetic engineering pharmaceuticals, can solve the problems of unpredictable results and immaturity, and achieve the effect of promoting platelet production and long half-life

Active Publication Date: 2019-02-26
LANZHOU UNIVERSITY
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, the expression of recombinant proteins is also affected by factors such as hosts, culture conditions, secretion pathways, and promoters. The current gene optimization theory and design methods are still immature, and there are various limitations. Gene optimization strategies It is a necessary but not sufficient condition for increasing the expression of recombinant proteins
To sum up, there is great uncertainty in the actual production and application of the strategy of improving the expression of genetically engineered strains through modification of yeast preferred codons, and the final result of modification for different target genes is unpredictable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein of thrombopoietin and preparation method and application thereof
  • Fusion protein of thrombopoietin and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Construction and expression of HSA-TMP fusion protein yeast expression vector

[0063] 1. Acquisition of p29-simple-TMP sequence

[0064] 1. First encode according to the preferred codon pair of Pichia pastoris (TMP) 2 optimized gene sequence.

[0065] 2. Entrust Dalian Takara Company to synthesize and optimize (TMP) 2 gene, (TMP) 2 The DNA sequence of the DNA sequence is shown in SEQ ID NO: 1, and it is loaded into p29-simple (p29-simple plasmid vector provided by Dalian Takara Company), and the vector p29-simple-(TMP) is obtained 2 .

[0066] 3. Wherein p29-simple-TMP already contains L, that is, the connecting peptide, the LDNA sequence is GGCGGCGGCGGTTCCGGACTGGAGCCCAAGAGCTGCGACAAGACCCACACCTGCCCTCCCTGCGAATTCGGTGGTGGCGG CAGC, and the amino acid sequence is GGGGSGLEPKSCDKTHTCPPCEF GGGGS.

[0067] 2. Cloning of fragments of HSA cDNA:

[0068] Obtained from plasmid pcDNA3.1-HSA clone (HSA complete gene sequence was synthesized by Bao Biological Company, p...

Embodiment 2

[0081] Example 2 HSA-(TMP) 2 Bioactivity detection of fusion protein

[0082] 1. Experimental process

[0083] Cell plating, c-mpl, c-fos, pAdVAntage, Renilla, four plasmid co-transfection. 48 hours after transfection, the positive control, blank control and test samples were added to detect firefly luciferase activity and Renilla luciferase activity, respectively, and calculate the fluorescence ratio.

[0084] Positive control: TPIAO TPIAO (recombinant human thrombopoietin injection) purchased from Shenyang Sansheng Pharmaceutical Co., Ltd.

[0085] Blank control: serum

[0086] Fluorescence ratio = firefly fluorescence value / renilla fluorescence value.

[0087] For specific steps, see Chinese patent (CN201310084212).

[0088] 2. Experimental results

[0089] Table 1 HSA-(TMP) 2 Bioactivity test results of fusion protein

[0090] test group

relative fluorescence ratio

Blank control group

1.00±0.02

positive control group

1.44±0.12 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of genetic engineering pharmacy, relates to a fusion protein of thrombopoietin and a preparation method and an application thereof, in particular to the fusion protein of a human serum albumin (HSA) and a yeast-preferred codon-encoded thrombopoietin mimetic peptide (TMP) diad and the preparation method and the application thereof. The fusion protein comprises theHSA molecule and the yeast-preferred codon-encoded TMP diad, the fusion protein can be stably expressed at a high level in yeast, and can be applied to industrial production; at the same time, the fusion protein has a characteristic of promoting thrombopoiesis significantly, has a long half-life in the human body, and can be used for preparing a medicine for treating various diseases such as primary or secondary thrombocytopenia.

Description

technical field [0001] The invention belongs to the field of genetic engineering pharmaceuticals, and relates to a fusion protein of thrombopoietin and its preparation method and application, in particular to a platelet-stimulating protein encoded by a human serum albumin molecule (Human serum Albumin, HSA) and a yeast preferred codon A fusion protein of Thrombopoietin Mimetic Peptide (TMP) duplex. Background technique [0002] In clinical practice, primary and secondary thrombocytopenia caused by various reasons are often encountered, such as primary thrombocytopenic purpura, aplastic anemia, and thrombocytopenia caused by tumor chemotherapy / radiotherapy. For such diseases, it is more suitable to use long-acting platelet-increasing drugs for treatment. On the one hand, it can reduce the number of medications and reduce the pain of acupuncture for patients; on the other hand, it can reduce the dosage of drugs and reduce treatment costs. [0003] Platelets are produced by me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/81C12N15/66A61K38/19A61P7/04
CPCC12N15/66C12N15/815C07K14/524C07K14/765A61K38/00C07K2319/00C12N2800/22Y02A50/30
Inventor李红玉张丽芸支德娟王梅竹李洋赵晶戴志娟王亚亚
OwnerLANZHOU UNIVERSITY