Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HBs-[alpha]317ScFv recombinant protein, and coding sequence, expression carrier, and applications thereof

A technology of 317scfv and recombinant protein, which is applied in the field of HBs-α317ScFv recombinant protein, can solve the problems of difficult pDCs cell uptake, processing and presentation, easy recurrence, and incomplete cure, etc., to achieve strong ability to activate immune response and antigen presentation High efficiency and the effect of reducing the amount of vaccine used

Inactive Publication Date: 2019-03-05
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there is no relevant report on the delivery of vaccines targeting CD317 for the treatment of HBV, it can be speculated from known clues that this strategy is likely to activate a stronger antiviral immune response by enhancing the antigen presentation efficiency of pDCs and break the pathology of CHB patients. Immune tolerance state, suppression or even elimination of HBV
[0010] The existing therapeutic drugs mainly include interferon (IFN-α) and oral nucleoside analogs (NAs). Although they can effectively inhibit the virus, they cannot be completely cured. There are problems such as long-term medication, viral drug resistance, and easy recurrence.
The protein-based therapeutic vaccines under development, such as ABX203 (clinical phase II / III, the main components are HBs and HBc), are soluble antigens that do not have the ability to target, and are difficult to be taken up, processed and presented by pDCs cells, so , unable to break the immune tolerance state caused by the loss of pDCs cell function in CHB patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HBs-[alpha]317ScFv recombinant protein, and coding sequence, expression carrier, and applications thereof
  • HBs-[alpha]317ScFv recombinant protein, and coding sequence, expression carrier, and applications thereof
  • HBs-[alpha]317ScFv recombinant protein, and coding sequence, expression carrier, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: HBs-α317scFv recombinant protein eukaryotic expression vector construction, its plasmid map structure is as follows figure 1 shown

[0036](1) The HBs coding gene is derived from the SH1203-C2 strain genome sequence (JX661494), with a total of 678 bases from 1550 to 2227 (SEQ ID NO: 1). Synthesized by Invitrogen, an auxiliary sequence (SEQ ID NO: 2) was added to the 5' end to facilitate vector transformation and protein secretion expression. The sequence includes EcoR1 restriction site, Kozak sequence, signal peptide (human tissue-type plasminogen activator, tPA , NM_000930, 258-323) and other elements.

[0037] Wherein, the sequence of SEQ ID NO: 1 is as follows:

[0038] a tggagaacac aacatcagga ttcctaggac ccctgctcgt gttacaggcg gggtttttcttgttgacaag aatcctcaca ataccacaga gtctagactc gtggtggact tctctcaatt ttctagggggagcacccacg tgtcctggcc aaaattcgca gtccccaacc tccaatcact caccaacctc ttgtcctccaatttgtcctg gctatcgttg gatgtgtctg cggcgtttta tcatattcct cttcatcctg ctgc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an HBs-[alpha]317ScFv recombinant protein, and a coding sequence, an expression carrier, and applications thereof. The HBs-[alpha]317ScFv recombinant protein comprises an aminoacid sequence coded by a nucleotide sequence represented by SEQ ID No.1 and an amino acid sequence coded by a nucleotide sequence represented by SEQ ID No.3. The HBs-[alpha]317ScFv recombinant proteincan prevent HBV infection, because the antigen presenting efficiency is high, the using amount of vaccines is reduced, and thus the cost is reduced. The HBs-[alpha]317ScFv recombinant protein can beused as a therapeutic vaccine and has a stronger performance on activating immune response, compared with a researched soluble non-target virus antigen.

Description

technical field [0001] The invention relates to the technical field of immunization, in particular to a HBs-α317ScFv recombinant protein, its coding sequence, expression vector and application. Background technique [0002] Hepatitis B virus (HBV) is the "culprit" of chronic hepatitis B, which can easily lead to liver cirrhosis and even liver cancer. Hepatitis B virus is generally transmitted through blood, sexual contact and mother to child in three ways, among which blood transmission is the most important way of transmission. [0003] Although preventive hepatitis B vaccines and antiviral drugs are on the market, 650,000 people worldwide still die from liver failure, cirrhosis and liver cancer caused by HBV infection every year. As a major hepatitis B country, China has about 93 million chronic HBV infections, of which about 20 million are chronic hepatitis B patients. Among patients with liver cirrhosis and liver cancer in my country, the proportions caused by HBV infe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62A61K38/17A61K48/00A61P1/16A61P31/20
CPCA61K38/00A61K48/00C07K14/005C07K16/2896C12N2730/10122
Inventor 万晓春章桂忠李欣
Owner SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products