HBs-[alpha]317ScFv recombinant protein, and coding sequence, expression carrier, and applications thereof
A technology of 317scfv and recombinant protein, which is applied in the field of HBs-α317ScFv recombinant protein, can solve the problems of difficult pDCs cell uptake, processing and presentation, easy recurrence, and incomplete cure, etc., to achieve strong ability to activate immune response and antigen presentation High efficiency and the effect of reducing the amount of vaccine used
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: HBs-α317scFv recombinant protein eukaryotic expression vector construction, its plasmid map structure is as follows figure 1 shown
[0036](1) The HBs coding gene is derived from the SH1203-C2 strain genome sequence (JX661494), with a total of 678 bases from 1550 to 2227 (SEQ ID NO: 1). Synthesized by Invitrogen, an auxiliary sequence (SEQ ID NO: 2) was added to the 5' end to facilitate vector transformation and protein secretion expression. The sequence includes EcoR1 restriction site, Kozak sequence, signal peptide (human tissue-type plasminogen activator, tPA , NM_000930, 258-323) and other elements.
[0037] Wherein, the sequence of SEQ ID NO: 1 is as follows:
[0038] a tggagaacac aacatcagga ttcctaggac ccctgctcgt gttacaggcg gggtttttcttgttgacaag aatcctcaca ataccacaga gtctagactc gtggtggact tctctcaatt ttctagggggagcacccacg tgtcctggcc aaaattcgca gtccccaacc tccaatcact caccaacctc ttgtcctccaatttgtcctg gctatcgttg gatgtgtctg cggcgtttta tcatattcct cttcatcctg ctgc...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com