Method and kit for trace FFPE RNA sample assessment and application
A micro, sample technology, applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc., can solve the experimental results and expected deviations, insensitive feedback on the degree of RINRNA degradation, RNA can not meet the minimum concentration requirements of 2100Bioanalyzer, etc. problem, to achieve the effect of low cost, high repeatability, easy promotion and popularization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0047] In this example, the trace FFPE RNA sample of prostate cancer is taken as an example to test the sample quality. The samples to be tested for prostate cancer include 24 precious trace FFPE RNA samples of FFPE slices of prostate cancer tissue. UHRR standard, UHRR is the abbreviation of Universal Human Reference RNA. The details are as follows:
[0048] 1. Design of primers and probes
[0049] In this case, two genes that have a strong correlation with the occurrence of prostate cancer and are often used as the main purpose of prostate cancer transcriptome sequencing research are selected as the key genes, namely the GUSB gene and the CDKN1A gene. Multiple real-time fluorescent PCR primers and probes were designed for these two genes, and their sequences are shown in Table 1.
[0050] Table 1 Primers and probes of GUSB gene and CDKN1A gene
[0051] name
Sequence (5'→3')
Seq ID No.
GUSB upstream primer
TGATCGCTCACACCAAAATCC
1
GUSB d...
PUM
Property | Measurement | Unit |
---|---|---|
PCR efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com