Supercharge Your Innovation With Domain-Expert AI Agents!

Method and kit for trace FFPE RNA sample assessment and application

A micro, sample technology, applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc., can solve the experimental results and expected deviations, insensitive feedback on the degree of RINRNA degradation, RNA can not meet the minimum concentration requirements of 2100Bioanalyzer, etc. problem, to achieve the effect of low cost, high repeatability, easy promotion and popularization

Pending Publication Date: 2019-04-09
BGI GENOMICS CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RIN is considered to be the gold standard for detecting the integrity of RNA samples, however its application still has many limitations
[0006] 1) RIN has a relatively high detection concentration threshold. Even if the highly sensitive Agilent RNA 6000 PicoKit is used, the concentration of the sample to be tested needs to reach 250pg / μL or more. For a large number of precious clinical samples to achieve molecular biology applications, it is undoubtedly is a huge constraint;
[0007] 2) RIN cannot directly predict the accuracy of gene quantitative experiment results
This simple cut-off, lack of full understanding of sample pre-processing methods and experimental design, will cause deviations in experimental results and expectations
[0008] 3) RIN basically cannot provide an effective indicator for the quality of FFPE RNA samples
Since FFPE RNA samples are often highly fragmented, RIN is not sensitive to feedback on the degree of RNA degradation, so it is impossible to predict the success rate of library construction and data reliability of the tested samples
Also, since FFPE RNA samples are highly degraded, 18S and 28S are often not visible, which limits the reference value of RIN
[0009] 4) RIN has a strict applicable concentration range, clinical samples are usually extremely precious, and often the extracted RNA cannot meet the minimum concentration requirements of 2100 Bioanalyzer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for trace FFPE RNA sample assessment and application
  • Method and kit for trace FFPE RNA sample assessment and application
  • Method and kit for trace FFPE RNA sample assessment and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047] In this example, the trace FFPE RNA sample of prostate cancer is taken as an example to test the sample quality. The samples to be tested for prostate cancer include 24 precious trace FFPE RNA samples of FFPE slices of prostate cancer tissue. UHRR standard, UHRR is the abbreviation of Universal Human Reference RNA. The details are as follows:

[0048] 1. Design of primers and probes

[0049] In this case, two genes that have a strong correlation with the occurrence of prostate cancer and are often used as the main purpose of prostate cancer transcriptome sequencing research are selected as the key genes, namely the GUSB gene and the CDKN1A gene. Multiple real-time fluorescent PCR primers and probes were designed for these two genes, and their sequences are shown in Table 1.

[0050] Table 1 Primers and probes of GUSB gene and CDKN1A gene

[0051] name

Sequence (5'→3')

Seq ID No.

GUSB upstream primer

TGATCGCTCACACCAAAATCC

1

GUSB d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method and a kit for trace FFPE RNA sample assessment and application. The method for the trace FFPE RNA sample assessment comprises the following steps: selecting a target fragment, and performing real-time fluorescent PCR on a trace FFPE RNA sample by using a specific primer and a probe of the target fragment; relatively quantifying by using a standard curve to obtain the relative concentration and abundance of the target fragment so as to assess the availability of the trace FFPE RNA sample. According to the method, the limitations of the current mainstream detection tool 2100 Bioanalyzer are broken through, and the real-time fluorescent PCR and the standard curve are used for relative quantification so as to judge the sample quality thereof; compared with the2100 Bioanalyzer method, the method provided by the invention has the advantage of capability of directly displaying the abundance and the availability of the target fragment; in addition, expensive capillary electrophoretic analysis equipment is not required to be purchased, the cost is lower, and generalization and popularization are easier.

Description

technical field [0001] The present application relates to the field of quality detection of nucleic acid samples, in particular to a method, kit and application for quality detection of trace FFPE RNA samples. Background technique [0002] With the vigorous development of next-generation sequencing technology NGS, transcriptome sequencing technology has become the main means of studying gene expression. Transcriptome is an inevitable link connecting genome genetic information and biological function, and is the basis and starting point for the study of gene function and structure. Through next-generation high-throughput sequencing, it is possible to comprehensively and quickly obtain almost all transcript sequence information of a specific tissue or organ of a species in a specific state, and has been widely used in basic research, clinical diagnosis, and drug development. [0003] In disease research and pathological analysis, after fresh tissue samples obtained by surgery...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2537/143C12Q2545/114C12Q2563/107
Inventor 宗亮陈翠刘红笑徐怀前
Owner BGI GENOMICS CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More